View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18618_high_6 (Length: 362)
Name: NF18618_high_6
Description: NF18618
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18618_high_6 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 144; Significance: 1e-75; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 144; E-Value: 1e-75
Query Start/End: Original strand, 17 - 184
Target Start/End: Complemental strand, 9251205 - 9251038
Alignment:
| Q |
17 |
aaattttggataataaggcagttccgttgggtcaatgtagcttgcctagagaaattgacagttcaaaattcatgcaaattttgtcattttgattaaaggt |
116 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||| ||| ||||||||||||| ||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
9251205 |
aaattttggataataaggcagttccgttgggccaatgtggctcgcctagagaaatttacagttcaaaattcatgcaaattttgtcattttaattaaaggt |
9251106 |
T |
 |
| Q |
117 |
tatcaaatactcactttctcatatgatcggcaatatttgatatttggtcaaatattagtgcttaattt |
184 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9251105 |
tatcaaatactcactttctcataggatcggcaatatttgatatttggtcaaatattagtgcttaattt |
9251038 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 129; E-Value: 1e-66
Query Start/End: Original strand, 226 - 362
Target Start/End: Complemental strand, 9250996 - 9250860
Alignment:
| Q |
226 |
gatattatattaaagaaccaacccattttttaaaataagagactaaagctttatttatttatttttgcaaaaataggagcagaaaatgcatatccaaaaa |
325 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9250996 |
gatattatattaaagaaccaacccattttttaaaataagagactaaagctttatttatttatttttgcaaaaataggagcagaaaatgcatatccaaaaa |
9250897 |
T |
 |
| Q |
326 |
agatgaatagtttttggctccggaagttgaatgaaat |
362 |
Q |
| |
|
|||| | |||||||||||||||||||||||||||||| |
|
|
| T |
9250896 |
agataattagtttttggctccggaagttgaatgaaat |
9250860 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University