View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18618_low_11 (Length: 239)
Name: NF18618_low_11
Description: NF18618
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18618_low_11 |
 | |
|
| [»] chr3 (1 HSPs) |
| |
|
Alignment Details
Target: chr3 (Bit Score: 225; Significance: 1e-124; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 225; E-Value: 1e-124
Query Start/End: Original strand, 11 - 239
Target Start/End: Original strand, 9250640 - 9250868
Alignment:
| Q |
11 |
catcatcaactcataatgtcaacatcgaaacgacatatgtactttaataaatttcattatactaataaaaaactaatgtaatttctagaacttctgcaaa |
110 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9250640 |
catcataaactcataatgtcaacatcgaaacgacatatgtactttaataaatttcattatactaataaaaaactaatgtaatttctagaacttctgcaaa |
9250739 |
T |
|
| Q |
111 |
tttttagtgttcaatgtctcacagctggttccatttagtttgaatctttttaaaatatgaatatattactgtgctgctggatcaaaattcaaaagtgagg |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9250740 |
tttttagtgttcaatgtctcacagctggttccatttagtttgaatctttttaaaatatgaatatattactgtgctgctggatcaaaattcaaaagtgagg |
9250839 |
T |
|
| Q |
211 |
attgcactatttgattcatgatttcattc |
239 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
9250840 |
attgcactatttgattcatgatttcattc |
9250868 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University