View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18618_low_4 (Length: 454)
Name: NF18618_low_4
Description: NF18618
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18618_low_4 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 227; Significance: 1e-125; HSPs: 3)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 227; E-Value: 1e-125
Query Start/End: Original strand, 112 - 446
Target Start/End: Complemental strand, 11616114 - 11615777
Alignment:
| Q |
112 |
cgtgggttgaatttacataaggtttattgattaacaatattagggtttgatttaagtatatttcttcgannnnnnnnnnnnnnaatgtatcaggtgatag |
211 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || ||||||||||||| ||| |
|
|
| T |
11616114 |
cgtgggttgaatttacataaggtttattgattaacaatattagggtttgatttaagtatatttctttgattttttttttt---aatgtatcaggtgttag |
11616018 |
T |
|
| Q |
212 |
atttcaagaaaaatcaaatgcatcgtgttaacttttggcttacaccaaagaatgaaaacaaggaccgaaaagcttcatcttttctcaataatgaagttgc |
311 |
Q |
| |
|
|||| ||| |||||||||||||||||| ||||||||||||||||||||||||| |||||||||||| |||||||||||||||||||||||||||||| || |
|
|
| T |
11616017 |
attttaaggaaaatcaaatgcatcgtgctaacttttggcttacaccaaagaatcaaaacaaggaccaaaaagcttcatcttttctcaataatgaagtagc |
11615918 |
T |
|
| Q |
312 |
aagtcttctggattccatatctgtttcgtcttcgtcttcgt------cttcatcttcttcttgggatgaatataagcctgtgacaaatgaagacaacaca |
405 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |||| ||||||||||| |
|
|
| T |
11615917 |
aagtcttctggattccatatctgtttcgtcttcgtcttcgtcttcctcttcatcttcttcttgggatgaatataagcctgtgataaataaagacaacaca |
11615818 |
T |
|
| Q |
406 |
agtcaacttgccccggatccacttttgcttaaacctatgct |
446 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
11615817 |
agtcaacttgcccctgatccacttttgcttaaacctatgct |
11615777 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 57; E-Value: 1e-23
Query Start/End: Original strand, 20 - 84
Target Start/End: Complemental strand, 11616179 - 11616115
Alignment:
| Q |
20 |
tggataaccttggctgtgcataattcttatttgatgaacatatgcatagatcttgagtggattaa |
84 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
11616179 |
tggaaaaccttggctgtgcataattcttatttgatgaaaatatgcatagatcttgagtggattaa |
11616115 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 195 - 264
Target Start/End: Original strand, 11605220 - 11605289
Alignment:
| Q |
195 |
aatgtatcaggtgatagatttcaagaaaaatcaaatgcatcgtgttaacttttggcttacaccaaagaat |
264 |
Q |
| |
|
||||||||||||| |||||||| | ||||||||||||||||| || |||||||||||||| |||||| |
|
|
| T |
11605220 |
aatgtatcaggtgctagatttctacgaaaatcaaatgcatcgtacaaaattttggcttacacccaagaat |
11605289 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 35; Significance: 0.0000000002; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 195 - 257
Target Start/End: Original strand, 8671695 - 8671757
Alignment:
| Q |
195 |
aatgtatcaggtgatagatttcaagaaaaatcaaatgcatcgtgttaacttttggcttacacc |
257 |
Q |
| |
|
||||||||||||| |||||||| || |||||||||||||||||| ||| | ||||||| |||| |
|
|
| T |
8671695 |
aatgtatcaggtgctagatttctaggaaaatcaaatgcatcgtgctaaatattggcttgcacc |
8671757 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 195 - 248
Target Start/End: Complemental strand, 8715396 - 8715343
Alignment:
| Q |
195 |
aatgtatcaggtgatagatttcaagaaaaatcaaatgcatcgtgttaacttttg |
248 |
Q |
| |
|
||||||||| ||| |||||||| || |||||||||||||||||||||| ||||| |
|
|
| T |
8715396 |
aatgtatcaagtgctagatttctaggaaaatcaaatgcatcgtgttaaattttg |
8715343 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 32; Significance: 0.00000001; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 195 - 238
Target Start/End: Original strand, 35078875 - 35078918
Alignment:
| Q |
195 |
aatgtatcaggtgatagatttcaagaaaaatcaaatgcatcgtg |
238 |
Q |
| |
|
||||||||||||| |||||||| || |||||||||||||||||| |
|
|
| T |
35078875 |
aatgtatcaggtgctagatttctaggaaaatcaaatgcatcgtg |
35078918 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University