View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18620_low_9 (Length: 327)
Name: NF18620_low_9
Description: NF18620
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18620_low_9 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 169; Significance: 1e-90; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 169; E-Value: 1e-90
Query Start/End: Original strand, 1 - 173
Target Start/End: Complemental strand, 40783014 - 40782842
Alignment:
| Q |
1 |
ttcctatggcactttttggacaaggtccaaccgctgcgcctgcggaggctcctgcaccgactaagccggagaaaagtgttcgggcttctgatgctccaaa |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40783014 |
ttcctatggcactttttggacaaggtccaaccgctgcgcctgcggaggctcctgcaccgactaagccggagaaaagtgttcgggcttctgatgctccaaa |
40782915 |
T |
|
| Q |
101 |
agggtcttcagatagtccggctgatgattcgagtgctgttggtttgaatggctacatagttaatggtgctaca |
173 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40782914 |
agggtcttcggatagtccggctgatgattcgagtgctgttggtttgaatggctacatagttaatggtgctaca |
40782842 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 286 - 321
Target Start/End: Complemental strand, 40782729 - 40782694
Alignment:
| Q |
286 |
ccttgagccagtttgagttgattgatgatgatgatg |
321 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
40782729 |
ccttgagccagtttgagttgattgatgatgatgatg |
40782694 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University