View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF18621_low_1 (Length: 243)

Name: NF18621_low_1
Description: NF18621
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF18621_low_1
NF18621_low_1
[»] chr8 (10 HSPs)
chr8 (46-213)||(39655626-39655796)
chr8 (46-204)||(17028375-17028534)
chr8 (46-204)||(17558811-17558970)
chr8 (46-215)||(21347132-21347293)
chr8 (18-140)||(1788901-1789035)
chr8 (46-133)||(21185330-21185418)
chr8 (84-212)||(31183760-31183883)
chr8 (104-145)||(38676893-38676934)
chr8 (106-145)||(17088767-17088806)
chr8 (46-145)||(38678707-38678804)
[»] chr1 (9 HSPs)
chr1 (46-215)||(4242496-4242666)
chr1 (46-202)||(12141592-12141749)
chr1 (46-215)||(24981090-24981259)
chr1 (46-213)||(47580415-47580584)
chr1 (62-171)||(9111512-9111622)
chr1 (103-213)||(51465563-51465671)
chr1 (46-117)||(1953708-1953780)
chr1 (157-213)||(1953800-1953856)
chr1 (46-145)||(43254135-43254235)
[»] chr4 (6 HSPs)
chr4 (46-213)||(44643473-44643640)
chr4 (46-140)||(6667721-6667816)
chr4 (46-171)||(895463-895589)
chr4 (46-145)||(13010530-13010630)
chr4 (99-157)||(20058088-20058146)
chr4 (46-140)||(6671393-6671482)
[»] chr2 (7 HSPs)
chr2 (46-204)||(14433537-14433697)
chr2 (46-204)||(18739058-18739208)
chr2 (46-145)||(2590521-2590621)
chr2 (46-145)||(21189422-21189522)
chr2 (18-140)||(35969279-35969409)
chr2 (46-124)||(1043166-1043244)
chr2 (166-226)||(35969220-35969280)
[»] chr7 (7 HSPs)
chr7 (46-203)||(39426390-39426548)
chr7 (70-205)||(22301089-22301224)
chr7 (45-194)||(3850487-3850638)
chr7 (18-204)||(11673983-11674172)
chr7 (46-148)||(31206620-31206723)
chr7 (46-140)||(31210077-31210172)
chr7 (70-145)||(13815783-13815858)
[»] chr5 (4 HSPs)
chr5 (70-217)||(26702942-26703090)
chr5 (70-217)||(26972675-26972823)
chr5 (46-171)||(18594835-18594961)
chr5 (18-129)||(39292087-39292203)
[»] chr6 (4 HSPs)
chr6 (18-204)||(19697791-19697981)
chr6 (84-204)||(15518076-15518196)
chr6 (54-153)||(6591838-6591938)
chr6 (70-145)||(24044930-24045005)
[»] scaffold0014 (1 HSPs)
scaffold0014 (46-140)||(82642-82737)
[»] scaffold0028 (2 HSPs)
scaffold0028 (47-171)||(110142-110267)
scaffold0028 (47-145)||(127721-127820)
[»] scaffold0076 (1 HSPs)
scaffold0076 (46-140)||(6762-6857)
[»] chr3 (4 HSPs)
chr3 (142-212)||(11634097-11634167)
chr3 (46-151)||(9372203-9372309)
chr3 (46-145)||(26445091-26445191)
chr3 (70-170)||(19930008-19930107)


Alignment Details
Target: chr8 (Bit Score: 104; Significance: 6e-52; HSPs: 10)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 104; E-Value: 6e-52
Query Start/End: Original strand, 46 - 213
Target Start/End: Complemental strand, 39655796 - 39655626
Alignment:
46 tatgattcataacggggaagaacggttgtatcttgggag-atatgcgcttttggggcggataaaatcctcaaggacagtgactatgtcatgcctcaagtt 144  Q
    ||||||||||||||| ||||||| |||||||| |||||| |||||| ||| || ||||||||||||||||||||||||||||||||||| |||||| |||    
39655796 tatgattcataacggagaagaactgttgtatcatgggaggatatgcacttatgaggcggataaaatcctcaaggacagtgactatgtcacgcctcaggtt 39655697  T
145 acttaacagtgtgctgttttg--caggtttcccctaatttgatttgtgaagattttgatggaactgtgtcg 213  Q
    ||||||||||||| |||||||  ||||||||| | ||||||||||||||||||||||||||| ||||||||    
39655696 acttaacagtgtgttgttttgcacaggtttcctccaatttgatttgtgaagattttgatggagctgtgtcg 39655626  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 88; E-Value: 2e-42
Query Start/End: Original strand, 46 - 204
Target Start/End: Original strand, 17028375 - 17028534
Alignment:
46 tatgattcataacggggaagaacggttgtatcttgggag-atatgcgcttttggggcggataaaatcctcaaggacagtgactatgtcatgcctcaagtt 144  Q
    ||||||||||||||||||||||| ||  |||| |||||| |||||||||  || ||||||||||||||||||||||||||||| ||||| |||||| |||    
17028375 tatgattcataacggggaagaactgtcatatcctgggaggatatgcgctaatgaggcggataaaatcctcaaggacagtgactgtgtcacgcctcaggtt 17028474  T
145 acttaacagtgtgctgttttgcaggtttcccctaatttgatttgtgaagattttgatgga 204  Q
    || ||| ||| |  |||||||||||||| |||||||||||||||||||||||||||||||    
17028475 acataatagtattttgttttgcaggttttccctaatttgatttgtgaagattttgatgga 17028534  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #3
Raw Score: 88; E-Value: 2e-42
Query Start/End: Original strand, 46 - 204
Target Start/End: Original strand, 17558811 - 17558970
Alignment:
46 tatgattcataacggggaagaacggttgtatcttgggag-atatgcgcttttggggcggataaaatcctcaaggacagtgactatgtcatgcctcaagtt 144  Q
    ||||||||||||||||||||||| ||  |||| |||||| |||||||||  || ||||||||||||||||||||||||||||| ||||| |||||| |||    
17558811 tatgattcataacggggaagaactgtcatatcctgggaggatatgcgctaatgaggcggataaaatcctcaaggacagtgactgtgtcacgcctcaggtt 17558910  T
145 acttaacagtgtgctgttttgcaggtttcccctaatttgatttgtgaagattttgatgga 204  Q
    || ||| ||| |  |||||||||||||| |||||||||||||||||||||||||||||||    
17558911 acataatagtattttgttttgcaggttttccctaatttgatttgtgaagattttgatgga 17558970  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #4
Raw Score: 71; E-Value: 3e-32
Query Start/End: Original strand, 46 - 215
Target Start/End: Original strand, 21347132 - 21347293
Alignment:
46 tatgattcataacggggaagaacggttgtatcttgggag-atatgcgcttttggggcggataaaatcctcaaggacagtgactatgtcatgcctcaagtt 144  Q
    |||||||||||||| | |||||| ||||||||||||||| ||||| |||| || |||||||||||||         ||||||||| ||| |||||| |||    
21347132 tatgattcataacgtgaaagaacagttgtatcttgggaggatatgtgcttatgaggcggataaaatc---------agtgactatatcacgcctcaggtt 21347222  T
145 acttaacagtgtgctgttttgcaggtttcccctaatttgatttgtgaagattttgatggaactgtgtcgac 215  Q
    |||||||||| ||| |||||||||||||||  ||||||||||||||||||||||||| || ||||||||||    
21347223 acttaacagtttgcagttttgcaggtttcctttaatttgatttgtgaagattttgatagagctgtgtcgac 21347293  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #5
Raw Score: 69; E-Value: 4e-31
Query Start/End: Original strand, 18 - 140
Target Start/End: Complemental strand, 1789035 - 1788901
Alignment:
18 atctttgagataaatttgagttgttctgt-----------atgattcataacggggaagaacggttgtatcttgggag-atatgcgcttttggggcggat 105  Q
    |||||||||||||||||||||||||||||           |||||||||||||||||||||| |||||||| |||||| |||||||||| || |||||||    
1789035 atctttgagataaatttgagttgttctgtcacctccggttatgattcataacggggaagaactgttgtatcctgggaggatatgcgcttatgaggcggat 1788936  T
106 aaaatcctcaaggacagtgactatgtcatgcctca 140  Q
    |||||||||||||||||||||||||||| ||||||    
1788935 aaaatcctcaaggacagtgactatgtcacgcctca 1788901  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #6
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 46 - 133
Target Start/End: Complemental strand, 21185418 - 21185330
Alignment:
46 tatgattcataacggggaagaacggttgtatcttgggag-atatgcgcttttggggcggataaaatcctcaaggacagtgactatgtca 133  Q
    |||||||||||||||||||||||  || |||  |||||| |||||||||| || |||||||||||||||||||||||||||||||||||    
21185418 tatgattcataacggggaagaactattatatgctgggaggatatgcgcttatgaggcggataaaatcctcaaggacagtgactatgtca 21185330  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #7
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 84 - 212
Target Start/End: Original strand, 31183760 - 31183883
Alignment:
84 gatatgcgcttttggggcggataaaatcctcaaggacagtgactatgtcatgcctcaagttacttaacagtgtgctgttttgcaggtttcccctaatttg 183  Q
    ||||||||||  || || ||||||||| |||||  ||||||| ||||||| |||||| |||||     |||||| || ||||||||||||  |||| |||    
31183760 gatatgcgctaatgaggtggataaaatactcaataacagtgattatgtcacgcctcatgttac-----agtgtgttgatttgcaggtttcttctaagttg 31183854  T
184 atttgtgaagattttgatggaactgtgtc 212  Q
    |||| |||||||||||||||| |||||||    
31183855 atttatgaagattttgatggagctgtgtc 31183883  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #8
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 104 - 145
Target Start/End: Original strand, 38676893 - 38676934
Alignment:
104 ataaaatcctcaaggacagtgactatgtcatgcctcaagtta 145  Q
    |||||||||||||||||||||||||||||| |||||| ||||    
38676893 ataaaatcctcaaggacagtgactatgtcacgcctcaggtta 38676934  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #9
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 106 - 145
Target Start/End: Complemental strand, 17088806 - 17088767
Alignment:
106 aaaatcctcaaggacagtgactatgtcatgcctcaagtta 145  Q
    |||||||||||||||||||||||||||| |||||| ||||    
17088806 aaaatcctcaaggacagtgactatgtcacgcctcaggtta 17088767  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #10
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 46 - 145
Target Start/End: Original strand, 38678707 - 38678804
Alignment:
46 tatgattcataacggggaagaacggttgtatcttggga-gatatgcgcttttggggcggataaaatcctcaaggacagtgactatgtcatgcctcaagtt 144  Q
    ||||||||||||||||||  ||| |||||||| ||  | ||||||||||| || | ||||| |||||||||| |||| ||||||||||| |||||| |||    
38678707 tatgattcataacgggga--aactgttgtatcctgtaaggatatgcgcttatgagacggatcaaatcctcaaagaca-tgactatgtcacgcctcaggtt 38678803  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1 (Bit Score: 95; Significance: 1e-46; HSPs: 9)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 95; E-Value: 1e-46
Query Start/End: Original strand, 46 - 215
Target Start/End: Complemental strand, 4242666 - 4242496
Alignment:
46 tatgattcataacggggaagaacggttgtatcttgggag-atatgcgcttttggggcggataaaatcctcaaggacagtgactatgtcatgcctcaagtt 144  Q
    ||||||||||||||||||||||| |||||||| |||||| |||||||||  || | |||||||||||||||||||||  || ||||||| | |||| |||    
4242666 tatgattcataacggggaagaacagttgtatcctgggaggatatgcgctcatgagtcggataaaatcctcaaggacaacgattatgtcacgtctcaggtt 4242567  T
145 acttaacagtgtgctgttttgcaggtttcccctaatttgatttgtgaagattttgatggaactgtgtcgac 215  Q
    |||||||||||||||||||||||||||||| | ||||||||||| |||||||||||||||  |||||||||    
4242566 acttaacagtgtgctgttttgcaggtttcctccaatttgatttgcgaagattttgatggagttgtgtcgac 4242496  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 90; E-Value: 1e-43
Query Start/End: Original strand, 46 - 202
Target Start/End: Complemental strand, 12141749 - 12141592
Alignment:
46 tatgattcataacggggaagaacggttgtatcttgggag-atatgcgcttttggggcggataaaatcctcaaggacagtgactatgtcatgcctcaagtt 144  Q
    ||||||||||||||||||| ||  |||||||| |||||| |||||||||| || ||||||||||||||||||||||||||||||||||| |||||| |||    
12141749 tatgattcataacggggaataattgttgtatcctgggaggatatgcgcttatgaggcggataaaatcctcaaggacagtgactatgtcacgcctcaggtt 12141650  T
145 acttaacagtgtgctgttttgcaggtttcccctaatttgatttgtgaagattttgatg 202  Q
    ||||||| ||||| |||||| || |||||   ||||||||||||||||||||||||||    
12141649 acttaacggtgtgttgttttacatgtttcttttaatttgatttgtgaagattttgatg 12141592  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #3
Raw Score: 83; E-Value: 2e-39
Query Start/End: Original strand, 46 - 215
Target Start/End: Complemental strand, 24981259 - 24981090
Alignment:
46 tatgattcataacggggaagaacggttgtatcttgggag-atatgcgcttttggggcggataaaatcctcaaggacagtgactatgtcatgcctcaagtt 144  Q
    ||||||||||||||||||||||| |||||||| |||||| ||||| |||| || ||||||||||||||||||||||  ||||||||||| |||||| |||    
24981259 tatgattcataacggggaagaactgttgtatcctgggaggatatgtgcttatgaggcggataaaatcctcaaggacgctgactatgtcacgcctcaggtt 24981160  T
145 acttaacagtgtgctgttttgcaggtttcccctaatttgatttgtgaagattttgatggaactgtgtcgac 215  Q
    || ||| ||| |  |||||||||||||||||||||||  |||||||||| ||||| ||||| |||||||||    
24981159 acataatagtattttgttttgcaggtttcccctaattaaatttgtgaaggttttg-tggaattgtgtcgac 24981090  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #4
Raw Score: 68; E-Value: 2e-30
Query Start/End: Original strand, 46 - 213
Target Start/End: Original strand, 47580415 - 47580584
Alignment:
46 tatgattcataacggggaagaacggttgtatcttgg--gag-atatgcgcttttggggcggataaaatcctcaaggacagtgactatgtcatgcctcaag 142  Q
    ||||||||||||||||||||| | |||||||| |||  ||| |||| ||||| || ||| ||||||||| ||||||||| ||||||||||| |||||| |    
47580415 tatgattcataacggggaagacctgttgtatcctggtggaggatattcgcttatgaggcagataaaatcttcaaggacattgactatgtcacgcctcagg 47580514  T
143 ttacttaacagtgtgctgttttgcaggtttcccctaatttgatttgtgaagattttgatggaactgtgtcg 213  Q
    | |||||| |||||||| ||||| |||||||| ||| |||||||||| ||||||| |||||| ||||||||    
47580515 taacttaatagtgtgct-ttttgtaggtttcctctactttgatttgttaagatttcgatggagctgtgtcg 47580584  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #5
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 62 - 171
Target Start/End: Complemental strand, 9111622 - 9111512
Alignment:
62 gaagaacggttgtatcttggga-gatatgcgcttttggggcggataaaatcctcaaggacagtgactatgtcatgcctcaagttacttaacagtgtgctg 160  Q
    ||||||| |||||||| ||||| ||||||||||| || ||||||||||||||||||||||||||||||||||| ||||||  |||  ||||||| | ||     
9111622 gaagaactgttgtatcctgggaagatatgcgcttatgaggcggataaaatcctcaaggacagtgactatgtcacgcctcagattatataacagtttacta 9111523  T
161 ttttgcaggtt 171  Q
    |||||||||||    
9111522 ttttgcaggtt 9111512  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #6
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 103 - 213
Target Start/End: Original strand, 51465563 - 51465671
Alignment:
103 gataaaatcctcaaggacagtgactatgtcatgcctcaagttacttaacagtgtgctgttttgcaggtttcccctaatttgatttgtgaagattttgatg 202  Q
    |||||||||  |||||||||||||||||||| ||||||  |||||| |||||||  ||||||  |||||||| ||| |||||||||||||||  ||||||    
51465563 gataaaatctccaaggacagtgactatgtcacgcctcagattactttacagtgtattgttttttaggtttcctctactttgatttgtgaaga--ttgatg 51465660  T
203 gaactgtgtcg 213  Q
    || ||||||||    
51465661 gagctgtgtcg 51465671  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #7
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 46 - 117
Target Start/End: Original strand, 1953708 - 1953780
Alignment:
46 tatgattcataacggggaagaacggttgtatcttggga-gatatgcgcttttggggcggataaaatcctcaag 117  Q
    ||||||||||||| ||||||||| |||||||| ||||| ||||| ||||| || ||| |||||||||||||||    
1953708 tatgattcataacagggaagaactgttgtatcctgggaggatattcgcttatgaggcagataaaatcctcaag 1953780  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #8
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 157 - 213
Target Start/End: Original strand, 1953800 - 1953856
Alignment:
157 gctgttttgcaggtttcccctaatttgatttgtgaagattttgatggaactgtgtcg 213  Q
    ||||||||| |||||||| ||| ||||||||||||||||||||||||  ||||||||    
1953800 gctgttttgtaggtttcctctactttgatttgtgaagattttgatggggctgtgtcg 1953856  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #9
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 46 - 145
Target Start/End: Original strand, 43254135 - 43254235
Alignment:
46 tatgattcataacggggaagaacg-gttgtatcttgggag-atatgcgcttttggggcggataaaatcctcaaggacagtgactatgtcatgcctcaagt 143  Q
    |||||||||||   |||||||||  |||||||| |||||| |||||||||| || |||| ||||| |||| ||||||||||||| ||||| |||||| ||    
43254135 tatgattcatatatgggaagaacatgttgtatcctgggaggatatgcgcttatgaggcgaataaa-tccttaaggacagtgactttgtcacgcctcatgt 43254233  T
144 ta 145  Q
    ||    
43254234 ta 43254235  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 85; Significance: 1e-40; HSPs: 6)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 85; E-Value: 1e-40
Query Start/End: Original strand, 46 - 213
Target Start/End: Original strand, 44643473 - 44643640
Alignment:
46 tatgattcataacggggaagaacggttgtatcttgggag-atatgcgcttttggggcggataaaatcctcaaggacagtgactatgtcatgcctcaagtt 144  Q
    ||||||||||| ||||||||||| |||||||| | |||| |||||||||| || |||||||| |||| | ||||||||||||||||||| |||||| |||    
44643473 tatgattcatatcggggaagaactgttgtatcctaggaggatatgcgcttatgaggcggatagaatc-tgaaggacagtgactatgtcacgcctcaggtt 44643571  T
145 acttaacagtgtgctgttttgcaggtttcccctaatttgatttgtgaagattttgatggaactgtgtcg 213  Q
    ||||||||| ||| ||||||||| |||||  ||||||||||||||||||||||||||||| || |||||    
44643572 acttaacagcgtgttgttttgcaagtttcttctaatttgatttgtgaagattttgatggagctttgtcg 44643640  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 64; E-Value: 4e-28
Query Start/End: Original strand, 46 - 140
Target Start/End: Complemental strand, 6667816 - 6667721
Alignment:
46 tatgattcataacggggaagaacggttgtatcttgggag-atatgcgcttttggggcggataaaatcctcaaggacagtgactatgtcatgcctca 140  Q
    ||||||||||||||||||||||| |||||||| |||||| |||||||||| || ||||||||||||||||||| ||||||||||||||| ||||||    
6667816 tatgattcataacggggaagaactgttgtatcctgggaggatatgcgcttatgaggcggataaaatcctcaagaacagtgactatgtcacgcctca 6667721  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #3
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 46 - 171
Target Start/End: Original strand, 895463 - 895589
Alignment:
46 tatgattcataacggggaagaacggttgtatcttgggag-atatgcgcttttggggcggataaaatcctcaaggacagtgactatgtcatgcctcaagtt 144  Q
    |||||||||||   |||||||||  ||||||| |||||| |||||||||| || ||||||||||||||||||||||||||||||||||| | |||| |||    
895463 tatgattcatattagggaagaacttttgtatcctgggaggatatgcgcttatgaggcggataaaatcctcaaggacagtgactatgtcacgactcaggtt 895562  T
145 acttaacagtgtgctgttttgcaggtt 171  Q
    |  ||||||| | || |||||||||||    
895563 agataacagtttactattttgcaggtt 895589  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #4
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 46 - 145
Target Start/End: Complemental strand, 13010630 - 13010530
Alignment:
46 tatgattcataacggggaagaacggttgtatcttgggag-atatgcgcttttggggcggataaaatcctcaaggacagtgactatgtcatgcctcaagtt 144  Q
    |||||||| |||||| ||||||| ||| |||| | |||| |||||||||| || ||||||||||||||||||||||||||||||||||| |||||| |||    
13010630 tatgattcgtaacggagaagaactgttatatcctaggaggatatgcgcttatgaggcggataaaatcctcaaggacagtgactatgtcacgcctcaggtt 13010531  T
145 a 145  Q
    |    
13010530 a 13010530  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #5
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 99 - 157
Target Start/End: Complemental strand, 20058146 - 20058088
Alignment:
99 ggcggataaaatcctcaaggacagtgactatgtcatgcctcaagttacttaacagtgtg 157  Q
    ||||||||||||||||||||||||||||||||||| |||||| ||||| ||||||||||    
20058146 ggcggataaaatcctcaaggacagtgactatgtcacgcctcaggttacataacagtgtg 20058088  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #6
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 46 - 140
Target Start/End: Complemental strand, 6671482 - 6671393
Alignment:
46 tatgattcataacggggaagaacggttgtatcttgggag-atatgcgcttttggggcggataaaatcctcaaggacagtgactatgtcatgcctca 140  Q
    ||||||||||||||||||||||| |||||||| |||||| |||||||       |||||||||||||||||||||| |||||||||||| ||||||    
6671482 tatgattcataacggggaagaactgttgtatcctgggaggatatgcga------ggcggataaaatcctcaaggacggtgactatgtcacgcctca 6671393  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2 (Bit Score: 85; Significance: 1e-40; HSPs: 7)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 85; E-Value: 1e-40
Query Start/End: Original strand, 46 - 204
Target Start/End: Complemental strand, 14433697 - 14433537
Alignment:
46 tatgattcataacggggaagaacg-gttgtatcttggga-gatatgcgcttttggggcggataaaatcctcaaggacagtgactatgtcatgcctcaagt 143  Q
    |||||||||||||||||||||||  |||||||||||||| ||| ||  ||| || |||||||||||||| |||||||||||||||||||| |||||| ||    
14433697 tatgattcataacggggaagaacatgttgtatcttgggaagatgtgtacttatgaggcggataaaatccacaaggacagtgactatgtcacgcctcaggt 14433598  T
144 tacttaacagtgtgctgttttgcaggtttcccctaatttgatttgtgaagattttgatgga 204  Q
    ||| |||||||||  |||||||||||||||  ||||||| |||||||||||||||||||||    
14433597 tacataacagtgtattgttttgcaggtttcttctaatttaatttgtgaagattttgatgga 14433537  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 67; E-Value: 7e-30
Query Start/End: Original strand, 46 - 204
Target Start/End: Complemental strand, 18739208 - 18739058
Alignment:
46 tatgattcataacggggaagaacggttgtatcttgggag-atatgcgcttttggggcggataaaatcctcaaggacagtgactatgtcatgcctcaagtt 144  Q
    ||||||||||||||||||||||| |||||||  |||||| |||||||||| || ||||||||||||||||||||||||||||||||||| ||||||||      
18739208 tatgattcataacggggaagaaccgttgtattgtgggaggatatgcgcttatgaggcggataaaatcctcaaggacagtgactatgtcacgcctcaag-- 18739111  T
145 acttaacagtgtgctgttttgcaggtttcccctaatttgatttgtgaagattttgatgga 204  Q
           |||||  |||||||||||||| ||||||||  |||||||||| ||||||||||    
18739110 ------aagtgttttgttttgcaggttt-ccctaattaaatttgtgaaggttttgatgga 18739058  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #3
Raw Score: 65; E-Value: 1e-28
Query Start/End: Original strand, 46 - 145
Target Start/End: Original strand, 2590521 - 2590621
Alignment:
46 tatgattcataacggggaagaacggttgtatcttgggag-atatgcgcttttggggcggataaaatcctcaaggacagtgactatgtcatgcctcaagtt 144  Q
    ||||||||||||||||||||||| |||||||| |||||| |||||||||| || |||| |||||||||||||||||||||||||||||| |||||| |||    
2590521 tatgattcataacggggaagaactgttgtatcctgggaggatatgcgcttatgaggcgaataaaatcctcaaggacagtgactatgtcacgcctcaggtt 2590620  T
145 a 145  Q
    |    
2590621 a 2590621  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #4
Raw Score: 61; E-Value: 3e-26
Query Start/End: Original strand, 46 - 145
Target Start/End: Original strand, 21189422 - 21189522
Alignment:
46 tatgattcataacggggaagaacggttgtatcttgggag-atatgcgcttttggggcggataaaatcctcaaggacagtgactatgtcatgcctcaagtt 144  Q
    ||||||||||||||||||| ||| ||||||||  ||||| |||||||||| || ||||||||||||||||||||||||||||||||||| |||||| |||    
21189422 tatgattcataacggggaataactgttgtatccggggaggatatgcgcttatgaggcggataaaatcctcaaggacagtgactatgtcacgcctcaggtt 21189521  T
145 a 145  Q
    |    
21189522 a 21189522  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #5
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 18 - 140
Target Start/End: Complemental strand, 35969409 - 35969279
Alignment:
18 atctttgagataaatttgagttgttctgt-----------atgattcataacggggaagaacggttgtatcttgggagatatgcgcttttggggcggata 106  Q
    |||||||||||||||||||||||||||||           |||||||||||||||||||||| ||| || | || ||  |||||||||||| ||||||||    
35969409 atctttgagataaatttgagttgttctgttacctcctgttatgattcataacggggaagaactgtt-taacatgtga--tatgcgcttttgaggcggata 35969313  T
107 aaatcctcaaggacagtgactatgtcatgcctca 140  Q
    ||||| ||||||||||||||||||||| ||||||    
35969312 aaatcttcaaggacagtgactatgtcacgcctca 35969279  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #6
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 46 - 124
Target Start/End: Original strand, 1043166 - 1043244
Alignment:
46 tatgattcataacggggaagaacggttgtatcttgggag-atatgcgcttttggggcggataaaatcctcaaggacagtg 124  Q
    |||||||||||||||| ||||||||||||||| |||||| |||||||| | || | ||||||||||||||||||||||||    
1043166 tatgattcataacggg-aagaacggttgtatcctgggaggatatgcgcctatgagacggataaaatcctcaaggacagtg 1043244  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #7
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 166 - 226
Target Start/End: Complemental strand, 35969280 - 35969220
Alignment:
166 caggtttcccctaatttgatttgtgaagattttgatggaactgtgtcgacgataatcaaat 226  Q
    ||||||||| ||||||| |||| ||||||||||||||||||||||||||||| || |||||    
35969280 caggtttcctctaatttaatttatgaagattttgatggaactgtgtcgacgacaaccaaat 35969220  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7 (Bit Score: 79; Significance: 5e-37; HSPs: 7)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 79; E-Value: 5e-37
Query Start/End: Original strand, 46 - 203
Target Start/End: Complemental strand, 39426548 - 39426390
Alignment:
46 tatgattcataacggggaagaacggttgtatcttgggag-atatgcgcttttggggcggataaaatcctcaaggacagtgactatgtcatgcctcaagtt 144  Q
    ||||||||||||| ||||||||| ||| ||||||||||| |||| ||||| || | ||||||||||||||||||||||||||||| ||| ||||||  ||    
39426548 tatgattcataacagggaagaactgttttatcttgggaggatattcgcttatgagacggataaaatcctcaaggacagtgactatatcacgcctcagatt 39426449  T
145 acttaacagtgtgctgttttgcaggtttcccctaatttgatttgtgaagattttgatgg 203  Q
    ||||||||||| | | ||||| |||||||| ||| ||||||||||||| ||||||||||    
39426448 acttaacagtgcgttattttgtaggtttcctctactttgatttgtgaaaattttgatgg 39426390  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 77; E-Value: 7e-36
Query Start/End: Original strand, 70 - 205
Target Start/End: Complemental strand, 22301224 - 22301089
Alignment:
70 gttgtatcttgggag-atatgcgcttttggggcggataaaatcctcaaggacagtgactatgtcatgcctcaagttacttaacagtgtgctgttttgcag 168  Q
    ||||||||||||||| |||||||||| || ||||||||||||||||||||||||||||||||||| |||||| ||||| ||| ||| |  ||||||||||    
22301224 gttgtatcttgggaggatatgcgcttatgaggcggataaaatcctcaaggacagtgactatgtcacgcctcaggttacataatagtattttgttttgcag 22301125  T
169 gtttcccctaatttgatttgtgaagattttgatggaa 205  Q
    |||| |||||| ||||||||||||| |||||||||||    
22301124 gttt-ccctaaattgatttgtgaaggttttgatggaa 22301089  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #3
Raw Score: 68; E-Value: 2e-30
Query Start/End: Original strand, 45 - 194
Target Start/End: Complemental strand, 3850638 - 3850487
Alignment:
45 gtatgattcataacggggaagaacg-gttgtatcttgggag-atatgcgcttttggggcggataaaatcctcaaggacagtgactatgtcatgcctcaag 142  Q
    |||||||||||| || ||||||||  |||||||| | |||| |||||||||| || |||| |||||||| ||||||||||||||||||||| ||||||      
3850638 gtatgattcataccgaggaagaactcgttgtatcataggaggatatgcgcttatgaggcgtataaaatcatcaaggacagtgactatgtcacgcctcaga 3850539  T
143 ttacttaacagtgtgctgttttgcaggtttcccctaatttgatttgtgaaga 194  Q
    |||| |||||||||| |||||| ||||||||| |||||||||||||| ||||    
3850538 ttacataacagtgtgttgttttacaggtttcctctaatttgatttgtaaaga 3850487  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #4
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 18 - 204
Target Start/End: Original strand, 11673983 - 11674172
Alignment:
18 atctttgagataaatttgagttgttctgt-----------atgattcataacggggaagaacggttgtatcttgggag-atatgcgcttttggggcggat 105  Q
    |||||||||||||||||||||||||||||           ||||||||||||||| || ||| |||||||| |||||| |||||||||| || |||||||    
11673983 atctttgagataaatttgagttgttctgtcacctccgattatgattcataacggg-aacaactgttgtatcctgggaggatatgcgcttatgaggcggat 11674081  T
106 aaaatcctcaaggacagtgactatgtcatgcctcaagttacttaacagtgtgctgttttgcaggtttcccctaatttgatttgtgaagattttgatgga 204  Q
    ||||||||||||||||||||||||||||  ||||| |         |||||  |||||||||||||||||||||||  |||||||||| ||||||||||    
11674082 aaaatcctcaaggacagtgactatgtcacacctcagg--------aagtgttttgttttgcaggtttcccctaattaaatttgtgaaggttttgatgga 11674172  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #5
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 46 - 148
Target Start/End: Complemental strand, 31206723 - 31206620
Alignment:
46 tatgattcataacggggaagaacggttgtatcttgggag-atatgcgcttttggggcggataaaatcctcaaggacagtgactatgtcatgcctcaagtt 144  Q
    ||||||||||||||||||||||| |||||||| ||  || |||||||||| || || ||||||||||||||| |||||||||||||||| |||||| |||    
31206723 tatgattcataacggggaagaactgttgtatcctgccaggatatgcgcttatgaggtggataaaatcctcaaagacagtgactatgtcacgcctcaggtt 31206624  T
145 actt 148  Q
    ||||    
31206623 actt 31206620  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #6
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 46 - 140
Target Start/End: Complemental strand, 31210172 - 31210077
Alignment:
46 tatgattcataacggggaagaacggttgtatcttgggag-atatgcgcttttggggcggataaaatcctcaaggacagtgactatgtcatgcctca 140  Q
    ||||||||||||||||||||||| |||||| |  ||||| |||||| ||| || ||||||||||||||||||||||||||||||||||| ||||||    
31210172 tatgattcataacggggaagaactgttgtaccccgggaggatatgcacttatgaggcggataaaatcctcaaggacagtgactatgtcacgcctca 31210077  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #7
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 70 - 145
Target Start/End: Original strand, 13815783 - 13815858
Alignment:
70 gttgtatcttggga-gatatgcgcttttggggcggataaaatcctcaaggacagtgactatgtcatgcctcaagtta 145  Q
    |||||||| ||||| ||||||||||| || |||| ||||| |||| ||||||||||||| ||||| |||||| ||||    
13815783 gttgtatcctgggaagatatgcgcttatgaggcgaataaa-tccttaaggacagtgactttgtcacgcctcatgtta 13815858  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5 (Bit Score: 77; Significance: 7e-36; HSPs: 4)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 77; E-Value: 7e-36
Query Start/End: Original strand, 70 - 217
Target Start/End: Complemental strand, 26703090 - 26702942
Alignment:
70 gttgtatcttgggag-atatgcgcttttggggcggataaaatcctcaaggacagtgactatgtcatgcctcaagttacttaacagtgtgctgttttgcag 168  Q
    ||||||||||||||| ||||||| || || |||||||||||||||||||||||||||||| |||| || ||| ||||| |||||||||  ||||| ||||    
26703090 gttgtatcttgggaggatatgcgtttatgaggcggataaaatcctcaaggacagtgactaagtcacgcatcaggttacataacagtgttttgtttagcag 26702991  T
169 gtttcccctaatttgatttgtgaagattttgatggaactgtgtcgacga 217  Q
    |||||| |||||||||||||||||| ||||||||||  | |||||||||    
26702990 gtttcctctaatttgatttgtgaaggttttgatggagttatgtcgacga 26702942  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 77; E-Value: 7e-36
Query Start/End: Original strand, 70 - 217
Target Start/End: Complemental strand, 26972823 - 26972675
Alignment:
70 gttgtatcttgggag-atatgcgcttttggggcggataaaatcctcaaggacagtgactatgtcatgcctcaagttacttaacagtgtgctgttttgcag 168  Q
    ||||||||||||||| ||||||| || || |||||||||||||||||||||||||||||| |||| || ||| ||||| |||||||||  ||||| ||||    
26972823 gttgtatcttgggaggatatgcgtttatgaggcggataaaatcctcaaggacagtgactaagtcacgcatcaggttacataacagtgttttgtttagcag 26972724  T
169 gtttcccctaatttgatttgtgaagattttgatggaactgtgtcgacga 217  Q
    |||||| |||||||||||||||||| ||||||||||  | |||||||||    
26972723 gtttcctctaatttgatttgtgaaggttttgatggagttatgtcgacga 26972675  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #3
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 46 - 171
Target Start/End: Original strand, 18594835 - 18594961
Alignment:
46 tatgattcataacggggaagaacggttgtatcttgggaga-tatgcgcttttggggcggataaaatcctcaaggacagtgactatgtcatgcctcaagtt 144  Q
    ||||||||||||||||||||||| |||||||| || |||| ||||||||| || ||||||||||||| |||||||||||||| |||||| |||||| |||    
18594835 tatgattcataacggggaagaactgttgtatcctgtgagaatatgcgcttatgaggcggataaaatcttcaaggacagtgacaatgtcacgcctcaggtt 18594934  T
145 acttaacagtgtgctgttttgcaggtt 171  Q
    || ||| ||| |  |||||||||||||    
18594935 acataatagtattttgttttgcaggtt 18594961  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #4
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 18 - 129
Target Start/End: Original strand, 39292087 - 39292203
Alignment:
18 atctttgagataaatttgagttgttctgt----atgattcataacggggaagaacggttgtatcttgggag-atatgcgcttttggggcggataaaatcc 112  Q
    ||||||||||| | ||||||||||| |||    |||||||||||||| ||||||| |||||||  ||| || |||||||||| || ||||||||||||||    
39292087 atctttgagattattttgagttgttatgtcaccatgattcataacggagaagaactgttgtattctggaaggatatgcgcttatgaggcggataaaatcc 39292186  T
113 tcaaggacagtgactat 129  Q
    | |||||||||||||||    
39292187 ttaaggacagtgactat 39292203  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6 (Bit Score: 71; Significance: 3e-32; HSPs: 4)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 71; E-Value: 3e-32
Query Start/End: Original strand, 18 - 204
Target Start/End: Complemental strand, 19697981 - 19697791
Alignment:
18 atctttgagataaatttgagttgttctgt-----------atgattcataacggggaagaacggttgtatcttgggag-atatgcgcttttggggcggat 105  Q
    |||||||||||||||||||||||||||||           |||||||||||||||||||||| |||||||| |||||| |||||||||| || |||||||    
19697981 atctttgagataaatttgagttgttctgtcacctccgattatgattcataacggggaagaactgttgtatcctgggaggatatgcgcttatgaggcggat 19697882  T
106 aaaatcctcaaggacagtgactatgtcatgcctcaagttacttaacagtgtgctgttttgcaggtttcccctaatttgatttgtgaagattttgatgga 204  Q
    |||||||||||||||| ||||||||||| ||||| |||        |||||  |||||||||||||||||||||||  |||||||||| ||||||||||    
19697881 aaaatcctcaaggacaatgactatgtcacgcctc-agt-------aagtgttttgttttgcaggtttcccctaattaaatttgtgaaggttttgatgga 19697791  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #2
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 84 - 204
Target Start/End: Original strand, 15518076 - 15518196
Alignment:
84 gatatgcgcttttggggcggataaaatcctcaaggacagtgactatgtcatgcctcaagttacttaacagtgtgctgttttgcaggtttcccct-aattt 182  Q
    ||||||||||| || |||||||| |||||||||||| ||||||||||||| | || | |||||||||||||||| ||||||||||||||||  | ||||     
15518076 gatatgcgcttatgaggcggatataatcctcaaggaaagtgactatgtcacgtct-aggttacttaacagtgtgttgttttgcaggtttcctataaatta 15518174  T
183 gatttgtgaagattttgatgga 204  Q
    ||||||||||||||| ||||||    
15518175 gatttgtgaagatttcgatgga 15518196  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #3
Raw Score: 57; E-Value: 6e-24
Query Start/End: Original strand, 54 - 153
Target Start/End: Complemental strand, 6591938 - 6591838
Alignment:
54 ataacggggaagaacggttgtatcttgggag-atatgcgcttttggggcggataaaatcctcaaggacagtgactatgtcatgcctcaagttacttaaca 152  Q
    ||||||| ||||||| |||| ||| |||||| |||||||||| || |||||||||||||||||||||||||||||| |||| |||||| |||||||||||    
6591938 ataacggagaagaactgttgcatcctgggaggatatgcgcttatgaggcggataaaatcctcaaggacagtgactacgtcacgcctcaggttacttaaca 6591839  T
153 g 153  Q
    |    
6591838 g 6591838  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #4
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 70 - 145
Target Start/End: Complemental strand, 24045005 - 24044930
Alignment:
70 gttgtatcttgggag-atatgcgcttttggggcggataaaatcctcaaggacagtgactatgtcatgcctcaagtta 145  Q
    |||||||| |||||| |||||||||| || |||| ||||| |||| ||||||||||||| ||||| |||||| ||||    
24045005 gttgtatcctgggaggatatgcgcttatgaggcgaataaa-tccttaaggacagtgactttgtcacgcctcatgtta 24044930  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0014 (Bit Score: 60; Significance: 1e-25; HSPs: 1)
Name: scaffold0014
Description:

Target: scaffold0014; HSP #1
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 46 - 140
Target Start/End: Original strand, 82642 - 82737
Alignment:
46 tatgattcataacggggaagaacggttgtatcttgggag-atatgcgcttttggggcggataaaatcctcaaggacagtgactatgtcatgcctca 140  Q
    ||||||| ||||||||||||||| |||||||| |||||| |||||||||| || ||||||||||||||||||||| ||||||||||||| ||||||    
82642 tatgatttataacggggaagaactgttgtatcctgggaggatatgcgcttatgaggcggataaaatcctcaaggatagtgactatgtcacgcctca 82737  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0028 (Bit Score: 58; Significance: 2e-24; HSPs: 2)
Name: scaffold0028
Description:

Target: scaffold0028; HSP #1
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 47 - 171
Target Start/End: Original strand, 110142 - 110267
Alignment:
47 atgattcataacggggaagaacggttgtatcttgggag-atatgcgcttttggggcggataaaatcctcaaggacagtgactatgtcatgcctcaagtta 145  Q
    |||||||||| | | ||||||| ||||||||||||||| ||||||| || || ||||||||||||||||||||||||||||||||||| |||||| ||||    
110142 atgattcatatcagcgaagaactgttgtatcttgggaggatatgcgtttatgaggcggataaaatcctcaaggacagtgactatgtcacgcctcatgtta 110241  T
146 cttaacagtgtgctgttttgcaggtt 171  Q
      ||||||  | || |||||||||||    
110242 gataacagattactattttgcaggtt 110267  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0028; HSP #2
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 47 - 145
Target Start/End: Original strand, 127721 - 127820
Alignment:
47 atgattcataacggggaagaacggttgtatcttgggag-atatgcgcttttggggcggataaaatcctcaaggacagtgactatgtcatgcctcaagtta 145  Q
    |||||||||| | ||||||||| |||||||| |||||| ||||||| || || ||||||||||||||||||||||||||||||||||| |||||| ||||    
127721 atgattcatatcagggaagaactgttgtatcatgggaggatatgcgtttctgaggcggataaaatcctcaaggacagtgactatgtcacgcctcaggtta 127820  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0076 (Bit Score: 44; Significance: 4e-16; HSPs: 1)
Name: scaffold0076
Description:

Target: scaffold0076; HSP #1
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 46 - 140
Target Start/End: Complemental strand, 6857 - 6762
Alignment:
46 tatgattcataacggggaagaacggttgtatcttgggag-atatgcgcttttggggcggataaaatcctcaaggacagtgactatgtcatgcctca 140  Q
    ||||||||||| | ||||| ||| |||||||| ||| || |||||| ||| || |||||||||||||||||| |||||||||||||||| ||||||    
6857 tatgattcatatcagggaaaaactgttgtatcatggaaggatatgcacttatgaggcggataaaatcctcaatgacagtgactatgtcacgcctca 6762  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3 (Bit Score: 43; Significance: 0.000000000000001; HSPs: 4)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 142 - 212
Target Start/End: Complemental strand, 11634167 - 11634097
Alignment:
142 gttacttaacagtgtgctgttttgcaggtttcccctaatttgatttgtgaagattttgatggaactgtgtc 212  Q
    ||||| |||||  ||| |||||||||||||||| ||||||||||||||||||||||||||| | |||||||    
11634167 gttacataacaacgtgttgttttgcaggtttcctctaatttgatttgtgaagattttgatgaagctgtgtc 11634097  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 46 - 151
Target Start/End: Complemental strand, 9372309 - 9372203
Alignment:
46 tatgattcataacggggaagaacg-gttgtatcttggga-gatatgcgcttttggggcggataaaatcctcaaggacagtgactatgtcatgcctcaagt 143  Q
    ||||||||||| | |||| ||||  |||||||| ||||| ||||||||||| || |||| ||||| |||| |||||||||||||  ||||||||||| ||    
9372309 tatgattcatatcagggatgaacctgttgtatcctgggacgatatgcgcttatgaggcgaataaa-tccttaaggacagtgacttcgtcatgcctcaggt 9372211  T
144 tacttaac 151  Q
    || |||||    
9372210 tatttaac 9372203  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #3
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 46 - 145
Target Start/End: Complemental strand, 26445191 - 26445091
Alignment:
46 tatgattcataacggggaagaacg-gttgtatcttgggag-atatgcgcttttggggcggataaaatcctcaaggacagtgactatgtcatgcctcaagt 143  Q
    ||||||||||| | |||||||||  |||||||||||  || |||| || || || |||||||||| |||| ||||||||||||| |||||||||||| ||    
26445191 tatgattcatatcagggaagaacatgttgtatcttgacaggatatacgattatgaggcggataaa-tccttaaggacagtgactttgtcatgcctcatgt 26445093  T
144 ta 145  Q
    ||    
26445092 ta 26445091  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #4
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 70 - 170
Target Start/End: Complemental strand, 19930107 - 19930008
Alignment:
70 gttgtatcttgggagatatgcgcttttggggcggataaaatcctcaaggacagtgactatgtcatgcctcaagttacttaacagtgtgctgttttgcagg 169  Q
    ||||||||| ||  ||||||||||| || ||||||| ||||||| |||||| |||||| ||||| |||||| ||||  |||| || | || |||||||||    
19930107 gttgtatctgggaggatatgcgcttatgaggcggat-aaatccttaaggacggtgactttgtcacgcctcatgttatataacggtttactattttgcagg 19930009  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University