View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18622_low_6 (Length: 426)
Name: NF18622_low_6
Description: NF18622
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18622_low_6 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 219; Significance: 1e-120; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 219; E-Value: 1e-120
Query Start/End: Original strand, 16 - 262
Target Start/End: Original strand, 5783284 - 5783530
Alignment:
| Q |
16 |
atgacataaataaatttggaggatttaaatctgagtaattatgaggtctcagtttcgatattgaggaggaggttgatgaatcgtaacatgatcccaaatt |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||| | ||| || |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5783284 |
atgacataaataaatttggaggatttaaatttaagtgatgatgaggtctcagtttcgatattgaggaggaggttgatgaatcgtaacatgatcccaaatt |
5783383 |
T |
 |
| Q |
116 |
gtgtttggtgggttggttcttgaccgatcgaccaattcttctccataatatgaaaatatatatgtccgaaatttggaggtcagtgaaaggtgtgatagtg |
215 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5783384 |
gtgtttggtgggtaggttcttgaccgatcgaccaattcatctccataatatgaaaatatatatgtccgaaatttggaggtcagtgaaaggtgtgatagtg |
5783483 |
T |
 |
| Q |
216 |
aaagaagcatatccatgactgtttcaatttcaattatgccataaatt |
262 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
5783484 |
aaagaagcatatccaggactgtttcaatttcaattatgccataaatt |
5783530 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University