View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18623_high_20 (Length: 291)
Name: NF18623_high_20
Description: NF18623
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18623_high_20 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 265; Significance: 1e-148; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 265; E-Value: 1e-148
Query Start/End: Original strand, 1 - 277
Target Start/End: Original strand, 32731852 - 32732128
Alignment:
| Q |
1 |
ggttatcctgaccctccggcgcatgggtcagcatagccgccgtgagtcctacccttctgcgtcatacgacttcctccaccaacgccatattgaaacggtt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32731852 |
ggttatcctgaccctccggcgcatgggtcagcatagccgccgtgagtcctacccttctgcgtcatacgacttcctccaccaacgccatattgaaacggtt |
32731951 |
T |
 |
| Q |
101 |
attggtgaagaagatgggctggaatggccatttggaaatgtggaaagtatgagcgctgatgatgtgagggagacagcgtatgagatctttttcacgtcat |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32731952 |
attggtgaagaagatgggctggaatggccatttggaaatgtggaaagtatgagcgctgatgatgtgagggagacagcgtatgagatctttttcacgtcat |
32732051 |
T |
 |
| Q |
201 |
gccgatcaacgccggggttcggtggacgtcaaacgctgacgttttattctaaccatgagaataatggaggtggtgga |
277 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |||| ||||||||||||| |
|
|
| T |
32732052 |
gccgatcaacgccggggtttggtggacgtcaaacgctgacgttttattctaaccatgacaatagtggaggtggtgga |
32732128 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University