View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18623_high_27 (Length: 247)
Name: NF18623_high_27
Description: NF18623
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18623_high_27 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 138; Significance: 3e-72; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 138; E-Value: 3e-72
Query Start/End: Original strand, 26 - 212
Target Start/End: Complemental strand, 39298480 - 39298298
Alignment:
| Q |
26 |
gcgtattttggaaaatttagttggtagtcagcaattttttatggaagaagaccaattttcctcgtgttatgtaacgtcgagactcatttcaattcaaaag |
125 |
Q |
| |
|
||||||||| | |||||||||||| ||| |||||||||||||||||||||| |||||||||| |||||||||||| |||||||||||||||||||||||| |
|
|
| T |
39298480 |
gcgtattttaggaaatttagttgggagtgagcaattttttatggaagaagagcaattttccttgtgttatgtaacatcgagactcatttcaattcaaaag |
39298381 |
T |
 |
| Q |
126 |
ttgggagaatagcttcccttcatgatctcacacaaacccttttggtctctctcttagaatcttgttgaaaaagacaagtacactgac |
212 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
39298380 |
ttgggagaatagcttcccttcatcatctcacacaaacccttttggtctctc----agaatcttgttgaaaaagacaagtacactgac |
39298298 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 30; Significance: 0.00000008; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 28 - 85
Target Start/End: Complemental strand, 13987383 - 13987326
Alignment:
| Q |
28 |
gtattttggaaaatttagttggtagtcagcaattttttatggaagaagaccaattttc |
85 |
Q |
| |
|
|||||||||||| ||| ||||| ||| |||||||||| |||| |||||| |||||||| |
|
|
| T |
13987383 |
gtattttggaaagtttggttggaagtgagcaatttttgatgggagaagagcaattttc |
13987326 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 30; Significance: 0.00000008; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 51 - 84
Target Start/End: Original strand, 10341116 - 10341149
Alignment:
| Q |
51 |
agtcagcaattttttatggaagaagaccaatttt |
84 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||| |
|
|
| T |
10341116 |
agtcagcaattttttatggaagaagaacaatttt |
10341149 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University