View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18623_high_30 (Length: 238)
Name: NF18623_high_30
Description: NF18623
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18623_high_30 |
 |  |
|
| [»] chr1 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 103; Significance: 2e-51; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 103; E-Value: 2e-51
Query Start/End: Original strand, 132 - 238
Target Start/End: Original strand, 46355616 - 46355722
Alignment:
| Q |
132 |
ttatacatggtgttacatggttattatatgactcacttttgcggttacccaacgtatatgttttgaaaccggatctccaaaaacatccttcgaagaacaa |
231 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
46355616 |
ttatacatggtgttacatggttattatatgactcacttttgcggttacccaacgtatatgttttgaaaccggatctccaaaaacatcctttgaagaacaa |
46355715 |
T |
 |
| Q |
232 |
actggta |
238 |
Q |
| |
|
||||||| |
|
|
| T |
46355716 |
actggta |
46355722 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University