View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF18623_high_30 (Length: 238)

Name: NF18623_high_30
Description: NF18623
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF18623_high_30
NF18623_high_30
[»] chr1 (1 HSPs)
chr1 (132-238)||(46355616-46355722)


Alignment Details
Target: chr1 (Bit Score: 103; Significance: 2e-51; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 103; E-Value: 2e-51
Query Start/End: Original strand, 132 - 238
Target Start/End: Original strand, 46355616 - 46355722
Alignment:
132 ttatacatggtgttacatggttattatatgactcacttttgcggttacccaacgtatatgttttgaaaccggatctccaaaaacatccttcgaagaacaa 231  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||    
46355616 ttatacatggtgttacatggttattatatgactcacttttgcggttacccaacgtatatgttttgaaaccggatctccaaaaacatcctttgaagaacaa 46355715  T
232 actggta 238  Q
    |||||||    
46355716 actggta 46355722  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University