View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18623_high_35 (Length: 213)
Name: NF18623_high_35
Description: NF18623
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18623_high_35 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 125; Significance: 1e-64; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 125; E-Value: 1e-64
Query Start/End: Original strand, 17 - 202
Target Start/End: Complemental strand, 46355876 - 46355691
Alignment:
| Q |
17 |
accttgtatatttggtgtaaataatgtgtgtgattccctcgttctacacattggatccatgcaannnnnnnacgatgccgcaaaagaaacnnnnnnnntg |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| | |
|
|
| T |
46355876 |
accttgtatatttggtgtaaataatgtgtgtgattccctcgttctacacattggatccatgcaatttttttacgatgccgcaaaagaaacaaaaaaaacg |
46355777 |
T |
|
| Q |
117 |
gacaaggatttgaagactagaaacctttaaaattagtttcattagaaatcagtttaccagtttgttcttcgaaggatattcttgga |
202 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| || ||||| |
|
|
| T |
46355776 |
gacaaggatttgaagactagaaacctttaaaattagtttcattagaaatcagtttaccagtttgttcttcaaaggatgtttttgga |
46355691 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University