View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18623_low_16 (Length: 349)
Name: NF18623_low_16
Description: NF18623
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18623_low_16 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 309; Significance: 1e-174; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 309; E-Value: 1e-174
Query Start/End: Original strand, 7 - 331
Target Start/End: Complemental strand, 31960268 - 31959944
Alignment:
| Q |
7 |
tccaagaatatcgattaatatgactcataaaacaatatcacaaggtaagaaaagttaccgatacgacatcacccaatgtagttttctgcagatcaggcag |
106 |
Q |
| |
|
|||||||| ||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31960268 |
tccaagaacatcgattaatatgacgcataaaacaatatcacaaggtaagaaaagttaccgatacgacatcacccaatgtagttttctgcagatcaggcat |
31960169 |
T |
|
| Q |
107 |
agtacgagtatttctggtagctgctgactgagctatggcacccaacccaccgggctcagtatgattctttccggtagctctcatttccgcggcctgtata |
206 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31960168 |
agtacgagtatttctggtagctgctgactgagctatggcacccaacccaccgggctcagtatgattctttccggtagctctcatttccgcggcctgtata |
31960069 |
T |
|
| Q |
207 |
gcagcagcatcactctgatccaatggcttatcaccggcttgactcaaagcagaagcttccagtgcctctccaatggttatagcattcttgtccaaaacca |
306 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31960068 |
gcagcagcatcactctgatccaacggcttatcaccggcttgactcaaagcagaagcttccagtgcctctccaatggttatagcattcttgtccaaaacca |
31959969 |
T |
|
| Q |
307 |
aaccaggatcattcataggcacatc |
331 |
Q |
| |
|
||||||||||||||||||||||||| |
|
|
| T |
31959968 |
aaccaggatcattcataggcacatc |
31959944 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University