View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18623_low_17 (Length: 348)
Name: NF18623_low_17
Description: NF18623
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18623_low_17 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 310; Significance: 1e-174; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 310; E-Value: 1e-174
Query Start/End: Original strand, 16 - 329
Target Start/End: Complemental strand, 6635395 - 6635082
Alignment:
| Q |
16 |
atgcagttttggcagcaccagagtattgcaatgcaaatttcacattttacttcacaccaacattttggtccaacccatctttgtctttaacattcacgaa |
115 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
6635395 |
atgcagttttggcagcaccagagtattgcaatgcaaatttcacattttacttcacaccaacattttggtccaacccatctttgtctttaacattcgcgaa |
6635296 |
T |
|
| Q |
116 |
tcgaaaagcttgttactttaataccggggttatggtaattgatctagaaaaatggcgcgacggagattacacaacaaagattgaggaatggatggaatta |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6635295 |
tcgaaaagcttgttactttaataccggggttatggtaattgatctagaaaaatggcgcgacggagattacacaacaaagattgaggaatggatggaatta |
6635196 |
T |
|
| Q |
216 |
caaaagaggatgagaatctatgaacttggttcattgccaccttttttgcttgtttttgcaggggaaattgttccagtggatcatagatggaatcaacatg |
315 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6635195 |
caaaagaggatgagaatctatgaacttggttcattgccaccttttttgcttgtttttgcaggggaaattgttccagtggatcatagatggaatcaacatg |
6635096 |
T |
|
| Q |
316 |
gtcttggtggtgat |
329 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
6635095 |
gtcttggtggtgat |
6635082 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 77; Significance: 1e-35; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 77; E-Value: 1e-35
Query Start/End: Original strand, 21 - 329
Target Start/End: Complemental strand, 52164285 - 52163977
Alignment:
| Q |
21 |
gttttggcagcaccagagtattgcaatgcaaatttcacattttacttcacaccaacattttggtccaacccatctttgtctttaacattcacgaatcgaa |
120 |
Q |
| |
|
||||| |||||||| || ||||| || |||||||||| | ||| || || ||| | |||||||| || || ||||||||| | || || ||||||||| |
|
|
| T |
52164285 |
gttttagcagcacctgaatattgtaacgcaaatttcagttcttattttactccatcgttttggtctaatccttctttgtctctcacttttgcgaatcgaa |
52164186 |
T |
|
| Q |
121 |
aagcttgttactttaataccggggttatggtaattgatctagaaaaatggcgcgacggagattacacaacaaagattgaggaatggatggaattacaaaa |
220 |
Q |
| |
|
| ||||||| || || || || || ||||| |||||| | ||| |||| | || || ||||| || ||||||||||||| |||||||| || || || |
|
|
| T |
52164185 |
agccttgttatttcaacacgggtgtgatggtgattgatttggaacgatggagagaaggggattatactgcaaagattgaggattggatggagttgcagaa |
52164086 |
T |
|
| Q |
221 |
gaggatgagaatctatgaacttggttcattgccaccttttttgcttgtttttgcaggggaaattgttccagtggatcatagatggaatcaacatggtctt |
320 |
Q |
| |
|
||||||||| ||||||||| | ||||| ||||| || ||||||||||||||||| ||| | |||| ||| ||||||||||| |||||||||||||| ||| |
|
|
| T |
52164085 |
gaggatgaggatctatgaattgggttcgttgccgccgtttttgcttgtttttgccgggaatattgctccggtggatcataggtggaatcaacatggactt |
52163986 |
T |
|
| Q |
321 |
ggtggtgat |
329 |
Q |
| |
|
||||||||| |
|
|
| T |
52163985 |
ggtggtgat |
52163977 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 55; Significance: 1e-22; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 191 - 329
Target Start/End: Complemental strand, 15964453 - 15964315
Alignment:
| Q |
191 |
aaagattgaggaatggatggaattacaaaagaggatgagaatctatgaacttggttcattgccaccttttttgcttgtttttgcaggggaaattgttcca |
290 |
Q |
| |
|
||||||||| | |||||||| |||||||||| || ||||||||||| || |||||||||||||||||||| |||||||||||||| | ||| | |
|
|
| T |
15964453 |
aaagattgaaaactggatggagttacaaaagaagagaagaatctatgagctaggttcattgccaccttttttacttgtttttgcaggaaatgttgaagct |
15964354 |
T |
|
| Q |
291 |
gtggatcatagatggaatcaacatggtcttggtggtgat |
329 |
Q |
| |
|
| ||||||||||||||||||||||| |||||||||||| |
|
|
| T |
15964353 |
attgatcatagatggaatcaacatggacttggtggtgat |
15964315 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 52; E-Value: 9e-21
Query Start/End: Original strand, 102 - 329
Target Start/End: Complemental strand, 7266613 - 7266386
Alignment:
| Q |
102 |
ttaacattcacgaatcgaaaagcttgttactttaataccggggttatggtaattgatctagaaaaatggcgcgacggagattacacaacaaagattgagg |
201 |
Q |
| |
|
||||||||| ||| ||| ||||| |||||||| || ||||| |||||||| |||||| ||| ||||| ||||||||| || || |||| || |
|
|
| T |
7266613 |
ttaacattcgcgactcggaaagcgtgttacttcaacaccggagttatggtgattgatttagcgcggtggcggatcggagattatacgacgcagatgacgg |
7266514 |
T |
|
| Q |
202 |
aatggatggaattacaaaagaggatgagaatctatgaacttggttcattgccaccttttttgcttgtttttgcaggggaaattgttccagtggatcatag |
301 |
Q |
| |
|
|||||||||| | || ||||| ||||| |||||||| |||||||||||||| || ||| |||||||||| ||||| |||| ||||| || |||||| | |
|
|
| T |
7266513 |
aatggatggagcttcagaagagaatgaggatctatgagcttggttcattgccgccgtttctgcttgttttcgcaggtaaaatagttccggttgatcatcg |
7266414 |
T |
|
| Q |
302 |
atggaatcaacatggtcttggtggtgat |
329 |
Q |
| |
|
|||||||||||||| ||||| |||||| |
|
|
| T |
7266413 |
gtggaatcaacatgggcttggcggtgat |
7266386 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 33; Significance: 0.000000002; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 297 - 329
Target Start/End: Complemental strand, 2498608 - 2498576
Alignment:
| Q |
297 |
catagatggaatcaacatggtcttggtggtgat |
329 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
2498608 |
catagatggaatcaacatggtcttggtggtgat |
2498576 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 33; Significance: 0.000000002; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 297 - 329
Target Start/End: Complemental strand, 27101196 - 27101164
Alignment:
| Q |
297 |
catagatggaatcaacatggtcttggtggtgat |
329 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
27101196 |
catagatggaatcaacatggtcttggtggtgat |
27101164 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 31; Significance: 0.00000003; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 204 - 274
Target Start/End: Original strand, 33346586 - 33346656
Alignment:
| Q |
204 |
tggatggaattacaaaagaggatgagaatctatgaacttggttcattgccaccttttttgcttgtttttgc |
274 |
Q |
| |
|
|||||||| || || ||||| |||||||||||||| |||||||| ||||| || |||||| | |||||||| |
|
|
| T |
33346586 |
tggatggagttgcagaagagaatgagaatctatgagcttggttcgttgccgccgtttttgttggtttttgc |
33346656 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University