View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18623_low_22 (Length: 296)
Name: NF18623_low_22
Description: NF18623
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18623_low_22 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 240; Significance: 1e-133; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 240; E-Value: 1e-133
Query Start/End: Original strand, 1 - 280
Target Start/End: Complemental strand, 54646770 - 54646490
Alignment:
| Q |
1 |
ttcgattctcaatgcc-gctagctactattatatgtgccacaatacacgcccctcnnnnnnncccaaacaccaaaaccacatttgtgtggtgaaattcct |
99 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54646770 |
ttcgattctcaatgccagctagctactattatatgtgccacaatacacgcccctcaaaaaaacccaaacaccaaaaccacatttgtgtggtgaaattcct |
54646671 |
T |
|
| Q |
100 |
agtcatgctagaatatatacggactcccaaagctaatttcgtctaataattacttatttgacattgccagttcggaccgttgtaggtaatatcctttctg |
199 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| | |
|
|
| T |
54646670 |
agtcatgctagaatatatacggactcccaaagctaatttcgtctaataattacttatttgacattgccagttcggatcgttgtaggtaatatcctttccg |
54646571 |
T |
|
| Q |
200 |
attcacatttctttttatcattttctgctgttttcttcatttcaagctctagctgcttacgattttcttcatgggctttgt |
280 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54646570 |
attcacatttctttttatcactttctgctgttttcttcatttcaagctctagctgcttacgattttcttcatgggctttgt |
54646490 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University