View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18623_low_25 (Length: 286)
Name: NF18623_low_25
Description: NF18623
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18623_low_25 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 201; Significance: 1e-110; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 201; E-Value: 1e-110
Query Start/End: Original strand, 13 - 266
Target Start/End: Complemental strand, 31842745 - 31842496
Alignment:
| Q |
13 |
aatatttaagcaaaaaattgacaagtttgaggttagttttcgtaatggttacagcagttatatcaatgtacaagtgtagatcct---agtacttatctca |
109 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| ||||||||||||| |
|
|
| T |
31842745 |
aatatttaagcaaaaaattgacaagtttgaggttagttttcgtaatggttacagcagttatagtaatgtacaagtgtagatcctgatagtacttatctca |
31842646 |
T |
 |
| Q |
110 |
catctcaatagagtttggttaatcaataattaggttagaagtaagtggtaaatgacgatgatatgagagcttaaaaattgtgctaaatattgtaggttca |
209 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
31842645 |
catctcaatagagtttggttaatca-------ggttagaagtaagtggtaaatgacgatgatatgagagcttaaaaattgtggtaaatattgtaggttca |
31842553 |
T |
 |
| Q |
210 |
aagtttgagacgcatagcattttgcagtgaaaattttgattcctgacaaattgacgc |
266 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
31842552 |
aagtttgagacgcatagcattttccagtgaaaattttgattcctgacaaattgacgc |
31842496 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University