View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18623_low_28 (Length: 261)
Name: NF18623_low_28
Description: NF18623
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18623_low_28 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 175; Significance: 3e-94; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 175; E-Value: 3e-94
Query Start/End: Original strand, 18 - 256
Target Start/End: Complemental strand, 31820294 - 31820052
Alignment:
| Q |
18 |
tttttatggaccgtgtgaaatgaattgaactcaattaaagtatgccgaatagtacaaatcatattgtatattccttgcccctcaaacaaactgta----t |
113 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
31820294 |
tttttatggaccgtgtgaaatgaattgaacttaattaaagtatgccgaatagtacaaatcatattgtatattccttgcccctcaaacaaactgtatatat |
31820195 |
T |
|
| Q |
114 |
atactgttcataataaatacagtttttatagtatgnnnnnnnnnnnnnggttgacaggtttacatagtattagtatgtattgtagaagttattttattca |
213 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31820194 |
atactgttcataataaatacagtttttatagtatgtttttctttttttggttgaaaggtttacatagtattagtatgtattgtagaagttattttattca |
31820095 |
T |
|
| Q |
214 |
ttttggaagaaaaacacgaggatgcattattattcttctcact |
256 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
31820094 |
ttttggaagaaaaacacgaggatgcattattattcttttcact |
31820052 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University