View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18623_low_30 (Length: 252)
Name: NF18623_low_30
Description: NF18623
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18623_low_30 |
 |  |
|
| [»] chr1 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 99; Significance: 6e-49; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 99; E-Value: 6e-49
Query Start/End: Original strand, 12 - 118
Target Start/End: Complemental strand, 2709547 - 2709441
Alignment:
| Q |
12 |
aagaaaatacaatcaaacttcaaaactcttttgttagaagtcggaggtttaggagttgacatgctaaaggatttattagcacctgttaccatataataag |
111 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
2709547 |
aagaaaatacaatcaaacttctaaactcttttgttagaagtcggaggtttaggagttgacatgctaaaggatttattagcacctgataccatataataag |
2709448 |
T |
 |
| Q |
112 |
gtcgata |
118 |
Q |
| |
|
||||||| |
|
|
| T |
2709447 |
gtcgata |
2709441 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 190 - 252
Target Start/End: Complemental strand, 2709367 - 2709306
Alignment:
| Q |
190 |
gttggaaaagtgataagatgcttgtattatttgaaactccagcaggttttgcccttttcaaat |
252 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2709367 |
gttggaaaagtgataagatgct-gtattatttgaaactccagcaggttttgcccttttcaaat |
2709306 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 59; Significance: 4e-25; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 59; E-Value: 4e-25
Query Start/End: Original strand, 190 - 252
Target Start/End: Original strand, 39833009 - 39833071
Alignment:
| Q |
190 |
gttggaaaagtgataagatgcttgtattatttgaaactccagcaggttttgcccttttcaaat |
252 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
39833009 |
gttggaaaagtgataagatgcttgtattatttgaaacaccagcaggttttgcccttttcaaat |
39833071 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 30; Significance: 0.00000009; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 16 - 73
Target Start/End: Original strand, 20143779 - 20143836
Alignment:
| Q |
16 |
aaatacaatcaaacttcaaaactcttttgttagaagtcggaggtttaggagttgacat |
73 |
Q |
| |
|
|||| ||||||||||| |||||||||||||||||| || ||||| ||||||||||| |
|
|
| T |
20143779 |
aaatgcaatcaaacttggaaactcttttgttagaagctggtggtttgggagttgacat |
20143836 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University