View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18623_low_34 (Length: 239)
Name: NF18623_low_34
Description: NF18623
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18623_low_34 |
 |  |
|
| [»] chr5 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 134; Significance: 7e-70; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 134; E-Value: 7e-70
Query Start/End: Original strand, 94 - 239
Target Start/End: Original strand, 2708531 - 2708676
Alignment:
| Q |
94 |
aacaatatacaaacatttgcattagtgctaaacattaactattgtctgttcacacaatcaacagaatatataccttgtctgcactatgcttcaacttgta |
193 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2708531 |
aacaatatacaaacatttgcattagtgcttaacattaactattgtctgttcacacaatcaacagaatatataccttgtctgcactatgcttcaacttgta |
2708630 |
T |
 |
| Q |
194 |
tattgataggctacgagacaaacccaacctcataggaggcatatct |
239 |
Q |
| |
|
|||||||||||||| |||||||||||||||||| |||||||||||| |
|
|
| T |
2708631 |
tattgataggctaccagacaaacccaacctcatcggaggcatatct |
2708676 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 165 - 231
Target Start/End: Original strand, 2702663 - 2702729
Alignment:
| Q |
165 |
accttgtctgcactatgcttcaacttgtatattgataggctacgagacaaacccaacctcataggag |
231 |
Q |
| |
|
|||||||||||||| ||||||||||||| ||||||||||| ||||||||||||| ||||| |||| |
|
|
| T |
2702663 |
accttgtctgcactgaacttcaacttgtatcttgataggctatgagacaaacccaagctcatcggag |
2702729 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University