View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18623_low_42 (Length: 201)
Name: NF18623_low_42
Description: NF18623
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18623_low_42 |
 | |
|
| [»] scaffold0901 (1 HSPs) |
| | |
|
| [»] scaffold0900 (1 HSPs) |
| | |
|
Alignment Details
Target: chr7 (Bit Score: 120; Significance: 1e-61; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 120; E-Value: 1e-61
Query Start/End: Original strand, 19 - 177
Target Start/End: Complemental strand, 15662091 - 15661932
Alignment:
| Q |
19 |
atataaatggatggaggagctaccttgtatatgcatcagaaatattgattaaagtttcttgatgttgaattgaaatttaactatacccttgcaggggaa- |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||||||||||||| ||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
15662091 |
atataaatggatggaggagctaccttgtatatgcattagaaatattgattagagtttcttgatgttgaattgaaatttaactatacccttgaaggggaag |
15661992 |
T |
|
| Q |
118 |
gcacttcaaaatgtactttattcaactacaaaagatgatgcaaatacaaaggcaaaactg |
177 |
Q |
| |
|
||| ||||||||||||||||||||| || ||||||| |||||||||| |||||||||||| |
|
|
| T |
15661991 |
gcagttcaaaatgtactttattcaaatagaaaagattatgcaaataccaaggcaaaactg |
15661932 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0901 (Bit Score: 60; Significance: 8e-26; HSPs: 1)
Name: scaffold0901
Description:
Target: scaffold0901; HSP #1
Raw Score: 60; E-Value: 8e-26
Query Start/End: Original strand, 83 - 182
Target Start/End: Original strand, 2502 - 2601
Alignment:
| Q |
83 |
ttgaattgaaatttaactatacccttgcaggggaagcacttcaaaatgtactttattcaactacaaaagatgatgcaaatacaaaggcaaaactgtaata |
182 |
Q |
| |
|
||||||||||||| ||||| ||| ||||||||||||||||||||| ||||||| |||||| | |||||||||||||||||| |||||||||||| |||| |
|
|
| T |
2502 |
ttgaattgaaattgaactaaacctttgcaggggaagcacttcaaatggtactttcttcaaccagaaaagatgatgcaaataccaaggcaaaactgcaata |
2601 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0900 (Bit Score: 60; Significance: 8e-26; HSPs: 1)
Name: scaffold0900
Description:
Target: scaffold0900; HSP #1
Raw Score: 60; E-Value: 8e-26
Query Start/End: Original strand, 83 - 182
Target Start/End: Complemental strand, 2115 - 2016
Alignment:
| Q |
83 |
ttgaattgaaatttaactatacccttgcaggggaagcacttcaaaatgtactttattcaactacaaaagatgatgcaaatacaaaggcaaaactgtaata |
182 |
Q |
| |
|
||||||||||||| ||||| ||| ||||||||||||||||||||| ||||||| |||||| | |||||||||||||||||| |||||||||||| |||| |
|
|
| T |
2115 |
ttgaattgaaattgaactaaacctttgcaggggaagcacttcaaatggtactttcttcaaccagaaaagatgatgcaaataccaaggcaaaactgcaata |
2016 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University