View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18624_high_18 (Length: 239)
Name: NF18624_high_18
Description: NF18624
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18624_high_18 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 203; Significance: 1e-111; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 203; E-Value: 1e-111
Query Start/End: Original strand, 17 - 227
Target Start/End: Complemental strand, 45861234 - 45861024
Alignment:
| Q |
17 |
aacatgtttattgtcttatgatctaaatatcaggtggtcaaactgctttagcattgagattactcctggctgctttttcatcaaagatatcttcaaatat |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45861234 |
aacatgtttattgtcttatgatctaaatatcaggtggtcaaactgctttagcattgagattactcctggctgctttttcatcaaagatatcttcaaatat |
45861135 |
T |
 |
| Q |
117 |
tgaccgcccttttggagatgaggtaatttcaaactcttctctatatttgtatagcttttggtaatataactcgttttgatagaaaaaatgtctattatgc |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
45861134 |
tgaccgcccttttggagatgaggtaatttcaaactcttctctatatttgtatagcttttggtaatagaactcgttttgatagaaaaaatgtctattatgc |
45861035 |
T |
 |
| Q |
217 |
agttctgtgct |
227 |
Q |
| |
|
||||| ||||| |
|
|
| T |
45861034 |
agttccgtgct |
45861024 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University