View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18624_low_24 (Length: 210)
Name: NF18624_low_24
Description: NF18624
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18624_low_24 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 93; Significance: 2e-45; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 93; E-Value: 2e-45
Query Start/End: Original strand, 12 - 117
Target Start/End: Original strand, 32905513 - 32905620
Alignment:
| Q |
12 |
aggagcagagagctggagacatatggggaagaagcaaactttaataacacatgaca--aacatcatgctgtgactgttgtccttttaaagaaacacctta |
109 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32905513 |
aggagcaaagagctggagacatatggggaagaagcaaactttaataacacatgacaacaacatcatgctgtgactgttgtccttttaaagaaacacctta |
32905612 |
T |
|
| Q |
110 |
actctctc |
117 |
Q |
| |
|
|||||||| |
|
|
| T |
32905613 |
actctctc |
32905620 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University