View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18625_high_10 (Length: 246)
Name: NF18625_high_10
Description: NF18625
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18625_high_10 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 194; Significance: 1e-105; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 194; E-Value: 1e-105
Query Start/End: Original strand, 13 - 227
Target Start/End: Original strand, 162985 - 163201
Alignment:
| Q |
13 |
taatactagttaactgtaaagaactgttactctatattctataca--gtgtttcgacctcaagccacatttctgcggtattgtttgcttttgagtcttgt |
110 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
162985 |
taatactagttaactgtaaagaactgttactctatattctatacacagtgtttcgacctcaagccacatttctgcggtattgtttgcttttgagtcttgt |
163084 |
T |
|
| Q |
111 |
gtgtaagacttcacggaactcatagtaagctattgtatgttactcatcagtcaagactttaggagcatgagccgttgatatttgcaaatcagtaagaaga |
210 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
163085 |
gtgtaagacttcacggaacttatagtaagctattgtatgttactcatcagtcaagactttaggagcatgagccgttgatatttgcaaataagtaagaaga |
163184 |
T |
|
| Q |
211 |
ttggtgagctacatgag |
227 |
Q |
| |
|
|||||||||||| |||| |
|
|
| T |
163185 |
ttggtgagctacgtgag |
163201 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University