View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18625_high_4 (Length: 456)
Name: NF18625_high_4
Description: NF18625
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18625_high_4 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 263; Significance: 1e-146; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 263; E-Value: 1e-146
Query Start/End: Original strand, 147 - 421
Target Start/End: Original strand, 11202184 - 11202458
Alignment:
| Q |
147 |
ccctaatcatgcccgcaatgaacaaccgcaagaagaattcacgcgacccatttttcgacgacggtcccaccaaacgccgtagagtagccgccgacgagga |
246 |
Q |
| |
|
|||||||||||||||| | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
11202184 |
ccctaatcatgcccgctaagaacaaccgcaagaagaattcacgcgacccatttttcgacgacggtcccaccaaacgccgcagagtagccgccgacgagga |
11202283 |
T |
 |
| Q |
247 |
tcaagatgctgagattgaaagtgatagtgattttgacgaagatggttttgttccatcgaaaggtgaaggggaacaggagtctgaagaggaaactacagct |
346 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11202284 |
tcaagatgctgagattgaaagtgatagtgattttgacgaagatggttttgttccatcgaaaggtgaaggggaacaggagtctgaagaggaaactacagct |
11202383 |
T |
 |
| Q |
347 |
gaagctaggaagagactagctgaggagtatttgaggaagtttaaagacagtgctaggagagagaaggaacaaaga |
421 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11202384 |
gaagctaggaagagactagctgaggagtatttgaggaagtttaaagacagtgctaggagagagaaggaacaaaga |
11202458 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 74; E-Value: 9e-34
Query Start/End: Original strand, 1 - 97
Target Start/End: Original strand, 11202041 - 11202134
Alignment:
| Q |
1 |
aaaaacatttgtaacttctacacaccgttcaaccgagagacataaacccactcatttctgaaacttaaaccctagcagcaacctttgtctttgtctc |
97 |
Q |
| |
|
|||||||||||||| |||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
11202041 |
aaaaacatttgtaaattctacac--cgttcaaccgagagacataaacccactcatttctgaaacttaaaccctagcagcaacctttgt-tttgtctc |
11202134 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University