View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18625_high_8 (Length: 366)
Name: NF18625_high_8
Description: NF18625
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18625_high_8 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 149; Significance: 1e-78; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 149; E-Value: 1e-78
Query Start/End: Original strand, 197 - 361
Target Start/End: Complemental strand, 47001034 - 47000871
Alignment:
| Q |
197 |
tatttatttattcacatcctcttcttaagaagataaaattgatctcttatattatgcttaatggttctcctattttatttaaattcacgaaaatagtcct |
296 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
47001034 |
tatttatttattcacatcctcttcttaagaagataaaattgatctcttatattatgcttaatggttctcctattttatt-aaattcacgaaaatagtcct |
47000936 |
T |
 |
| Q |
297 |
caatcgaactttttggtgtctttattttcacatttattgtaattttagtcccaacctatgcttct |
361 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |||| |
|
|
| T |
47000935 |
caatcgaactttttggtgtctttattttcacatttattgtaattttagtcccaacccatgtttct |
47000871 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 146; E-Value: 8e-77
Query Start/End: Original strand, 18 - 171
Target Start/End: Complemental strand, 47001187 - 47001034
Alignment:
| Q |
18 |
agttgaacttggcatatgcatgactcccatcagatatgtcaccaaattgactgcaatccccatggtggaaagcctctcaacaatttcaatccctgtaaca |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
47001187 |
agttgaacttggcatatgcatgactcccatcagatatgtcaccaaattgactgcaatccccatggtggaaagcctctcaacaatttcaatccctgtagca |
47001088 |
T |
 |
| Q |
118 |
attttgacaagtccattacactcttagatttcatcattcacagtaactttttat |
171 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
47001087 |
attttgacaagtccattacactcttagatttcatcattcacagtaaatttttat |
47001034 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University