View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18625_low_12 (Length: 217)
Name: NF18625_low_12
Description: NF18625
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18625_low_12 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 170; Significance: 2e-91; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 170; E-Value: 2e-91
Query Start/End: Original strand, 27 - 200
Target Start/End: Original strand, 43343191 - 43343364
Alignment:
| Q |
27 |
atatgaaacgcttatagaaataatttatataataaaagcttaattgatcagatgttttattcaaacagtttatctaatttgattataatgaattaatagg |
126 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
43343191 |
atatgaaacgcttatagaaataatttatataataaaagcttaattgatcagatgttttattcaaacagttgatctaatttgattataatgaattaatagg |
43343290 |
T |
|
| Q |
127 |
tatggaactcaacaacttcttccaaatggagaattcatggtgataggaggacggagatcatttagctacgaatt |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43343291 |
tatggaactcaacaacttcttccaaatggagaattcatggtgataggaggacggagatcatttagctacgaatt |
43343364 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University