View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18626_high_10 (Length: 277)
Name: NF18626_high_10
Description: NF18626
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18626_high_10 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 219; Significance: 1e-120; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 219; E-Value: 1e-120
Query Start/End: Original strand, 18 - 272
Target Start/End: Original strand, 31115670 - 31115924
Alignment:
| Q |
18 |
ttttgtactggagctagggtttgtctcctattattgtttaatgcttcaatttaatatcactatttagtggtcatttcatgtattacctcaaaaattggaa |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
31115670 |
ttttgtactggagctagggtttgtctcctattattgtttaatgcttcaatttaatatcactatttagtggccatttcatgtattacctcaaaaattggaa |
31115769 |
T |
 |
| Q |
118 |
ttagtggtactggtaagaacatataccctagatcttgtcctcaggcaatgaccttcataaagatcaaagagctagcgggaatggatgatcgtgttaaaga |
217 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
31115770 |
ttagtggtactggtaagaacatataccctagatcttgtcctcaggcaatgaccttcataaagatcgaagagctagcgggaatggatgatcgtgttaaaga |
31115869 |
T |
 |
| Q |
218 |
ggcnnnnnnnnggtattggaaaactacatgtagtcagcagcatcagaataattta |
272 |
Q |
| |
|
||| |||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
31115870 |
ggcaaaaaaaaggtattggaaaactacatgtagtcagcagcatcagagtaattta |
31115924 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University