View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18626_high_12 (Length: 273)
Name: NF18626_high_12
Description: NF18626
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18626_high_12 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 251; Significance: 1e-139; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 251; E-Value: 1e-139
Query Start/End: Original strand, 1 - 259
Target Start/End: Complemental strand, 35352877 - 35352619
Alignment:
| Q |
1 |
tttattcacttgtaggaccatgcacttccttatgtactatacaccttgcaaagcgactttggaccatcgaacttctactcaagtgatttcatctctccaa |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35352877 |
tttattcacttgtaggaccatgcacttccttatgtactatacaccttgcaaagcgactttggaccatcgaacttctactcaagtgatttcatctctccaa |
35352778 |
T |
 |
| Q |
101 |
agagacgatgttggcatcaacaaccttgcatcctgggacatatgaactgcagcatcgtggaactttagtatcacactctcaatgtcttcaacatcgatta |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
35352777 |
agagacgatgttggcatcaacaaccttgcatcctgggacatatgaactgcagcatcgtggaactttagtatcacactctcaatgccttcaacatcgatta |
35352678 |
T |
 |
| Q |
201 |
tgttaccatttcctaacttgaaatccccaaacacgccattagtctttaaggtgtcgaat |
259 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
35352677 |
tgttaccatttcctaacttgaaatccccaaacatgccattagtctttaaggtgtcgaat |
35352619 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University