View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18626_high_15 (Length: 245)
Name: NF18626_high_15
Description: NF18626
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18626_high_15 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 165; Significance: 2e-88; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 165; E-Value: 2e-88
Query Start/End: Original strand, 4 - 207
Target Start/End: Original strand, 1179113 - 1179327
Alignment:
| Q |
4 |
caaaatcaatgaagttgaaaattctcgatcattagatga-----------ctgcgaaatgatctcagaaagactagtgtgatcaacaattttcatattca |
92 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| ||||||| |||||| |
|
|
| T |
1179113 |
caaaatcaatgaaattgaaaattctcgatcattagatgagttaatttagcctgcgaaatgatctcagaaagactagtgtgatcaagaattttcttattca |
1179212 |
T |
 |
| Q |
93 |
gaaatcattttggaattttattaaaattcatggggaaaataacctgcacaacattctctgggaccaaattaaattggttcatgttcaactaattgacctt |
192 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1179213 |
gaaatcattttggaattttattaaaattcatggggaaaataacctgcacaacattctctgggaccaaattaaattggttcatgttcaactaattgacctt |
1179312 |
T |
 |
| Q |
193 |
gaagcatcatctatc |
207 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
1179313 |
gaagcatcatctatc |
1179327 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 60 - 106
Target Start/End: Complemental strand, 35029247 - 35029201
Alignment:
| Q |
60 |
aaagactagtgtgatcaacaattttcatattcagaaatcattttgga |
106 |
Q |
| |
|
|||||||||||||||| | |||||||||||||| || |||||||||| |
|
|
| T |
35029247 |
aaagactagtgtgatcgagaattttcatattcaaaagtcattttgga |
35029201 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University