View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18626_low_10 (Length: 344)
Name: NF18626_low_10
Description: NF18626
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18626_low_10 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 132; Significance: 2e-68; HSPs: 3)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 132; E-Value: 2e-68
Query Start/End: Original strand, 1 - 136
Target Start/End: Complemental strand, 1179102 - 1178967
Alignment:
| Q |
1 |
tccttaacccctaacaatttcatgcattaaaacatgattcattcatgagtagaatctaccacataggtgataataattctagatcttgaactaacgatgg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1179102 |
tccttaacccctaacaatttcatgcattaaaacatgattcattcatgagtagaatctaccacataggtgataataattctagatcttgaactaacgatgg |
1179003 |
T |
 |
| Q |
101 |
atgtaactgaaaagtaacttaaaatgtagctcaaaa |
136 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||| |
|
|
| T |
1179002 |
atgtaactgaaaagtaacttaaaatgtaactcaaaa |
1178967 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 123 - 184
Target Start/End: Complemental strand, 1178897 - 1178836
Alignment:
| Q |
123 |
aatgtagctcaaaatttagacagcggcatagaatgcaacttaaacaatcttagaaaccatga |
184 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1178897 |
aatgtaactcaaaatttagacagcggcatagaatgcaacttaaacaatcttagaaaccatga |
1178836 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 89 - 136
Target Start/End: Original strand, 43169688 - 43169735
Alignment:
| Q |
89 |
aactaacgatggatgtaactgaaaagtaacttaaaatgtagctcaaaa |
136 |
Q |
| |
|
|||||||||| ||||||||||||||| ||||||||||||| ||||||| |
|
|
| T |
43169688 |
aactaacgatagatgtaactgaaaagcaacttaaaatgtaactcaaaa |
43169735 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 33; Significance: 0.000000002; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 130 - 182
Target Start/End: Complemental strand, 37500229 - 37500177
Alignment:
| Q |
130 |
ctcaaaatttagacagcggcatagaatgcaacttaaacaatcttagaaaccat |
182 |
Q |
| |
|
||||||||||||||||| ||| |||||||||||||||| |||||||||||| |
|
|
| T |
37500229 |
ctcaaaatttagacagcatcatgcaatgcaacttaaacaaacttagaaaccat |
37500177 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University