View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18627_high_17 (Length: 245)
Name: NF18627_high_17
Description: NF18627
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18627_high_17 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 156; Significance: 5e-83; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 156; E-Value: 5e-83
Query Start/End: Original strand, 15 - 222
Target Start/End: Original strand, 26137880 - 26138084
Alignment:
| Q |
15 |
gaaacaattcaagaggatactatgaaaaagaagnnnnnnnnttggtttgcagatttccggactccttagagtaagttctttatttgattgttgcctactc |
114 |
Q |
| |
|
|||||||||||||| ||| ||||||||||||| ||||||||||||||||||||||||||| |||||||||||||||||||||| |||||||| |
|
|
| T |
26137880 |
gaaacaattcaagatgatgctatgaaaaagaa---ataaaattggtttgcagatttccggactccttacagtaagttctttatttgattgtcgcctactc |
26137976 |
T |
 |
| Q |
115 |
gcccatattttcatatttgtcacttaattgcatcttttattattggttgagaacagtccttttgtcccataaaatttttcctcatgtgggtgttgtgtct |
214 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
26137977 |
gcccatattttcatatttgtcacttaattgcatcttttattattggttgagaacagtccttttgtcccataaaatctttcctcatgtgggtgttgtgtct |
26138076 |
T |
 |
| Q |
215 |
ttttatgt |
222 |
Q |
| |
|
|||||||| |
|
|
| T |
26138077 |
ttttatgt |
26138084 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University