View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18627_high_22 (Length: 204)
Name: NF18627_high_22
Description: NF18627
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18627_high_22 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 165; Significance: 2e-88; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 165; E-Value: 2e-88
Query Start/End: Original strand, 16 - 188
Target Start/End: Complemental strand, 2310203 - 2310031
Alignment:
| Q |
16 |
catagggatgaactattgaaatattgtccaataggactaactggttcttgtaactgctcctctttctcgtattccattttgcaaagaaaaatatcaatca |
115 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
2310203 |
catagggatgagctattgaaatattgtccaataggactaactggttcttgtaactgctcctctttttcgtattccattttgcaaagaaaaatatcaatca |
2310104 |
T |
 |
| Q |
116 |
aactttaggatatgatagttggtgggagaatgaaattgaattattgaatttgaagtatatatataggtaaatc |
188 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2310103 |
aactttaggatatgatagttggtgggagaatgaaattgaattattgaatttgaagtatatatataggtaaatc |
2310031 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University