View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18627_low_10 (Length: 341)
Name: NF18627_low_10
Description: NF18627
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18627_low_10 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 246; Significance: 1e-136; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 246; E-Value: 1e-136
Query Start/End: Original strand, 17 - 322
Target Start/End: Original strand, 41249312 - 41249607
Alignment:
| Q |
17 |
ttgaacacaacatctttatccaaaacctaagacataagttaaaatgctcaacatccactattgtatccaacgtgaaactcttactcagaaatgaaatgat |
116 |
Q |
| |
|
|||||||||||| ||||||||||||||||| |||||||||||||||||||||||||||| |||||||||| ||||||||||||||||||||||| | |
|
|
| T |
41249312 |
ttgaacacaacaactttatccaaaacctaacacataagttaaaatgctcaacatccacttttgtatccaatgtgaaactcttactcagaaatga-----t |
41249406 |
T |
|
| Q |
117 |
acaggaacacaaacaaacttgttattgttagaccaaattaaatatatcactataaactctaaggcagactcgttttgctggtcctctcatatttctgatc |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41249407 |
acaggaacacaaacaaacttgttattgttagaccaaat-----atatcactataaactctaaggcagactcgttttgctggtcctctcatatttctgatc |
41249501 |
T |
|
| Q |
217 |
gtgatgtaaaaatatacagaatagatgctccccaacctctgttcacaacgtggttgctaatcagtacattacatggatatcttgcttggatataattggt |
316 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41249502 |
gtgatgtaaaaatatacagaatagatgctccccaacctctgttcacaacgtggtttctaatcagtacattacatggatatcttgcttggatataattggt |
41249601 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University