View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18627_low_16 (Length: 254)
Name: NF18627_low_16
Description: NF18627
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18627_low_16 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 79; Significance: 5e-37; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 79; E-Value: 5e-37
Query Start/End: Original strand, 31 - 117
Target Start/End: Original strand, 21538848 - 21538934
Alignment:
| Q |
31 |
atagtatggtttattgtttttggtggaggttaaaccaccgaagaatcaagacctatgaatcacagtcatctttaaaattagaagtgt |
117 |
Q |
| |
|
||||| ||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21538848 |
atagtgtggtttattatttttggtggaggttaaaccaccgaagaatcaagacctatgaatcacagtcatctttaaaattagaagtgt |
21538934 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 48 - 84
Target Start/End: Original strand, 21524433 - 21524469
Alignment:
| Q |
48 |
ttttggtggaggttaaaccaccgaagaatcaagacct |
84 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
21524433 |
ttttggtggagtttaaaccaccgaagaatcaagacct |
21524469 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University