View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18627_low_22 (Length: 228)
Name: NF18627_low_22
Description: NF18627
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18627_low_22 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 149; Significance: 7e-79; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 149; E-Value: 7e-79
Query Start/End: Original strand, 51 - 211
Target Start/End: Original strand, 8786076 - 8786236
Alignment:
| Q |
51 |
aattgttgactccgcccctgcatgtccgtgaactcaattaatgaacgtctcgacaagaggtcactactcaacctctaaagagcacaacggctaagaagag |
150 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
8786076 |
aattgttgactccgccactgcatgtccgtgaactcaattaatgaacgtctcgacaagaggtcactactcaacctctaaagagcacaagggctaagaagag |
8786175 |
T |
|
| Q |
151 |
gcaacgagaggagcttcctaaggaaaatgaacttaaaaatatgactgaactacatatatct |
211 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
8786176 |
gcaacgagaggagcttcctaaggagaatgaacttaaaaatatgactgaactacatatatct |
8786236 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University