View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18628_high_12 (Length: 236)
Name: NF18628_high_12
Description: NF18628
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18628_high_12 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 138; Significance: 3e-72; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 138; E-Value: 3e-72
Query Start/End: Original strand, 34 - 222
Target Start/End: Complemental strand, 47290184 - 47290006
Alignment:
| Q |
34 |
ttgagctgatagttagtcttttttatcaactaatcagacatccggactttcaagcacaaacgagtaagaacatgatgtccttaggtaatttgattgactc |
133 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
47290184 |
ttgagctgatagttagtcttttttatcaactaatcagacatctggactttcaagcacaaacgagtaagaacatgatgtccttagggaatttgattgactc |
47290085 |
T |
 |
| Q |
134 |
tactagcattgtcgaatagaactatatacaactatatataaccaaaattttacaaaggtgtaaccatatgtttttcttgcgtgcaaaat |
222 |
Q |
| |
|
||||||||||||||| ||| ||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
47290084 |
tactagcattgtcga----------atataactatatataaccaaaattttacaaaggcgtaaccatatgtttttcttgcgtgcaaaat |
47290006 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 96; Significance: 3e-47; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 96; E-Value: 3e-47
Query Start/End: Original strand, 34 - 161
Target Start/End: Complemental strand, 39175698 - 39175571
Alignment:
| Q |
34 |
ttgagctgatagttagtcttttttatcaactaatcagacatccggactttcaagcacaaacgagtaagaacatgatgtccttaggtaatttgattgactc |
133 |
Q |
| |
|
|||||||||||| | || |||||||||| ||||||| |||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39175698 |
ttgagctgataggtggtgttttttatcatctaatcaaacatccagactttcaagcacaaacgagtaagaacatgatgtccttaggtaatttgattgactt |
39175599 |
T |
 |
| Q |
134 |
tactagcattgtcgaatagaactatata |
161 |
Q |
| |
|
|||||||||||||||||| ||||||||| |
|
|
| T |
39175598 |
tactagcattgtcgaataaaactatata |
39175571 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 174 - 220
Target Start/End: Complemental strand, 39175548 - 39175503
Alignment:
| Q |
174 |
accaaaattttacaaaggtgtaaccatatgtttttcttgcgtgcaaa |
220 |
Q |
| |
|
|||||||||||||||||| ||||||||||| ||||||||| |||||| |
|
|
| T |
39175548 |
accaaaattttacaaaggcgtaaccatatg-ttttcttgcatgcaaa |
39175503 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 168 - 222
Target Start/End: Complemental strand, 19535285 - 19535231
Alignment:
| Q |
168 |
tatataaccaaaattttacaaaggtgtaaccatatgtttttcttgcgtgcaaaat |
222 |
Q |
| |
|
|||||| ||| ||||||||||| | |||||||||| |||||||||||| |||||| |
|
|
| T |
19535285 |
tatatacccacaattttacaaacgagtaaccatatttttttcttgcgttcaaaat |
19535231 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 30; Significance: 0.00000008; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 169 - 222
Target Start/End: Complemental strand, 195880 - 195827
Alignment:
| Q |
169 |
atataaccaaaattttacaaaggtgtaaccatatgtttttcttgcgtgcaaaat |
222 |
Q |
| |
|
||||| ||| ||||||||||||| |||||||||| |||||| ||||| |||||| |
|
|
| T |
195880 |
atatacccacaattttacaaaggagtaaccatatttttttcctgcgttcaaaat |
195827 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University