View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18628_high_4 (Length: 407)
Name: NF18628_high_4
Description: NF18628
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18628_high_4 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 368; Significance: 0; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 368; E-Value: 0
Query Start/End: Original strand, 1 - 372
Target Start/End: Complemental strand, 46939855 - 46939484
Alignment:
| Q |
1 |
agaaattcagtgtcttgcatagaagcatcatcatcaccagcaataaaaagaggaatcatagttgaagaaggaagaaaatcagtgtcttatgttgatgaaa |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46939855 |
agaaattcagtgtcttgcatagaagcatcatcatcaccagcaataaaaagaggaatcatagttgaagaaggaagaaaatcagtgtcttatgttgatgaaa |
46939756 |
T |
 |
| Q |
101 |
caaagttagcagcagaagaaaaggtaggtaaatttgttgaggcaagaaaatcagtgtcccatattgaaacattgtcttctgttattgaaaaacttcaagt |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46939755 |
caaagttagcagcagaagaaaaggtaggtaaatttgttgaggcaagaaaatcagtgtcccatattgaaacattgtcttctgttattgaaaaacttcaagt |
46939656 |
T |
 |
| Q |
201 |
gaaggttttggtctcagacatgccaagtttcatgcaagtgcatgcttttcgttgtgcaagaaggacatatgatagtcttgaggagtttagctccaaacac |
300 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46939655 |
gaaggttttggtctcagacatgccaagtttcatgcaagtgcatgcttttcgttgtgcaagaaggacatatgatagtcttgaggagtttagctccaaacac |
46939556 |
T |
 |
| Q |
301 |
attgctcataacattaagaaggtatatgctaattatgctttaattttcacatctctatttatatattaatta |
372 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
46939555 |
attgctcataacattaagaaggtatatgctaattatgctttaattttcacatctctatttatatatttatta |
46939484 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University