View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18628_low_13 (Length: 248)
Name: NF18628_low_13
Description: NF18628
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18628_low_13 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 118; Significance: 3e-60; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 118; E-Value: 3e-60
Query Start/End: Original strand, 102 - 231
Target Start/End: Complemental strand, 35904322 - 35904193
Alignment:
| Q |
102 |
taccacgaattcaaatagttattttatgggtcacattattgttttaaattgactagtgtataattatatccgaatcatataatctctttcacatacaaag |
201 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
35904322 |
taccacgaattcaaatagttattttatgggtcacattattgttttaaattgactaatgtataattatatccgaatcatataatctctttcacgtacaaag |
35904223 |
T |
|
| Q |
202 |
atctatctagtgaagtcccacagctaaaac |
231 |
Q |
| |
|
||||||||||||||||| |||||||||||| |
|
|
| T |
35904222 |
atctatctagtgaagtctcacagctaaaac |
35904193 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 71; E-Value: 3e-32
Query Start/End: Original strand, 29 - 103
Target Start/End: Complemental strand, 35904549 - 35904475
Alignment:
| Q |
29 |
aagataaatttagagtcatgagatgagactatttgacaaataaaataaaaatatatccaccgttgtctagtgtta |
103 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
35904549 |
aagataaatttagagtcatgagatgagactatttgacaaaaaaaataaaaatatatccaccgttgtctagtgtta |
35904475 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University