View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18628_low_8 (Length: 330)
Name: NF18628_low_8
Description: NF18628
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18628_low_8 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 135; Significance: 3e-70; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 135; E-Value: 3e-70
Query Start/End: Original strand, 126 - 312
Target Start/End: Original strand, 19175457 - 19175643
Alignment:
| Q |
126 |
tatcagtagcagttaacaatagtttttccactgtaaccgacggtgaggcagaggaaattactgtaacagagagggaaaaaacagagcaagagatatcctt |
225 |
Q |
| |
|
||||||||||||| ||||| |||||||| ||||| |||||| | ||||||||||| || |||||||||||||||| ||| |||||||||||| ||||||| |
|
|
| T |
19175457 |
tatcagtagcagtaaacaagagtttttctactgtcaccgactgcgaggcagaggagatcactgtaacagagagggcaaagacagagcaagagttatcctt |
19175556 |
T |
 |
| Q |
226 |
tttggccattctcgtgacccttttcaggaaatccctagtttcttgcgctagtgatgcttctgccatggaaattggtcaccctactaa |
312 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19175557 |
tttggccattcttgtgacccttttcaggaaatccctagtttcttgcgccagtgatgcttctgccatggaaattggtcaccctactaa |
19175643 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 61; E-Value: 4e-26
Query Start/End: Original strand, 22 - 86
Target Start/End: Original strand, 19175347 - 19175411
Alignment:
| Q |
22 |
catggctgaagttctacactcttctgatcccattcacattcacactaccgaccaacaacaacaac |
86 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
19175347 |
catggctgaagttctacactcttctgatcccattcacattcacactaccgaccaagaacaacaac |
19175411 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University