View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18629_high_6 (Length: 492)
Name: NF18629_high_6
Description: NF18629
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18629_high_6 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 441; Significance: 0; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 441; E-Value: 0
Query Start/End: Original strand, 18 - 482
Target Start/End: Complemental strand, 28927679 - 28927215
Alignment:
| Q |
18 |
tcgaatgctttgattcatgggtatgctggattttgtgaactgggttttgcgcgtaaggtgtttgatgaaatgtctgatagggatttggtttcttggaatt |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
28927679 |
tcgaatgctttgattcatgggtatgctggattttgtgaactgggttttgcgcgtaaggtgtttgatgaaatgtctgaaagggatttggtttcttggaatt |
28927580 |
T |
 |
| Q |
118 |
cgttgatttgtgggtatggtcggtgtaggaggtatagggaggttttgggtgtttttgaagaaatgaggatggctgatgtgaagggtgatgctgtgacaat |
217 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28927579 |
cgttgatttgtgggtatggtcggtgtaggaggtatagcgaggttttggttgtttttgaagaaatgaggatggctgatgtgaagggtgatgctgtgacaat |
28927480 |
T |
 |
| Q |
218 |
ggtgaaagttgttttggcgtgtacggttttgggtgagtggggtgttgttgatgctatgattgagtatattgaggaaaataaggtggaggttgatgtttac |
317 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28927479 |
ggtgaaagttgttttggcgtgtacggttttgggtgagtggggtgttgttgatgctatgattgagtatattgaggaaaataaggtggaggttgatgtttac |
28927380 |
T |
 |
| Q |
318 |
ttgggaaatacattgattgatatgtatggccggcgcagtatggttgatttggctcgacaagtgtttaatcggatgcgtgatagaaatatggtttcttgga |
417 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
28927379 |
ctgggaaatacattgattgatatgtatggccggcgcagtatggttgatttggctcgacgagtgtttgatcggatgcgtgatagaaatatggtttcttgga |
28927280 |
T |
 |
| Q |
418 |
atgctatgattatgggttatgggaaagcaggaaacttggttgctgcaaggaaattgtttgatgat |
482 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28927279 |
atgctatgattatgggttatgggaaagcaggaaacttggttgctgcaaggaaattgtttgatgat |
28927215 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 32; Significance: 0.00000001; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 64 - 135
Target Start/End: Original strand, 16045248 - 16045319
Alignment:
| Q |
64 |
ttgcgcgtaaggtgtttgatgaaatgtctgatagggatttggtttcttggaattcgttgatttgtgggtatg |
135 |
Q |
| |
|
||||||||||||||||||||||||| |||| | ||||||||| || |||||||| ||| | | |||||||| |
|
|
| T |
16045248 |
ttgcgcgtaaggtgtttgatgaaattactgagaaggatttggtgtcgtggaattcattgttgtctgggtatg |
16045319 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University