View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18629_low_23 (Length: 239)
Name: NF18629_low_23
Description: NF18629
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18629_low_23 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 132; Significance: 1e-68; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 132; E-Value: 1e-68
Query Start/End: Original strand, 59 - 220
Target Start/End: Complemental strand, 22921743 - 22921586
Alignment:
| Q |
59 |
ttttactattcttagtttaaccaattgtagtaagtagacatcttaaaatagaatcgggagaaaacaatttccaactctttttgagggaaacaatttccaa |
158 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |||||||||||||||||||||| |
|
|
| T |
22921743 |
ttttactattcttagtttaaccaattgtagtaagtagacatcttaaaatagaatcgggagaaaacaatttccaattc-ttttgagggaaacaatttccaa |
22921645 |
T |
 |
| Q |
159 |
cttttcacaactgaagatttttatccatgcaataagattttcgtggaaaattgaattgtggg |
220 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||| |||||||||||||||||| |
|
|
| T |
22921644 |
cttttcacaactgaagatttttatccatgc---aagattttcgaggaaaattgaattgtggg |
22921586 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 132; E-Value: 1e-68
Query Start/End: Original strand, 59 - 220
Target Start/End: Original strand, 22970056 - 22970213
Alignment:
| Q |
59 |
ttttactattcttagtttaaccaattgtagtaagtagacatcttaaaatagaatcgggagaaaacaatttccaactctttttgagggaaacaatttccaa |
158 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |||||||||||||||||||||| |
|
|
| T |
22970056 |
ttttactattcttagtttaaccaattgtagtaagtagacatcttaaaatagaatcgggagaaaacaatttccaattc-ttttgagggaaacaatttccaa |
22970154 |
T |
 |
| Q |
159 |
cttttcacaactgaagatttttatccatgcaataagattttcgtggaaaattgaattgtggg |
220 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||| |||||||||||||||||| |
|
|
| T |
22970155 |
cttttcacaactgaagatttttatccatgc---aagattttcgaggaaaattgaattgtggg |
22970213 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University