View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18629_low_24 (Length: 238)
Name: NF18629_low_24
Description: NF18629
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18629_low_24 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 156; Significance: 5e-83; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 156; E-Value: 5e-83
Query Start/End: Original strand, 35 - 224
Target Start/End: Original strand, 19142683 - 19142871
Alignment:
| Q |
35 |
ggtaaaattagtgtgatctagatttttgcatgttactaaccatnnnnnnngagaagaatgaaaaatttagggcaagatttgaaagaaacaaggataacta |
134 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19142683 |
ggtaaaattagtgtgatctagatttttgcatgttactaaccataaaaaa-gagaagaatgaaaaatttagggcaagatttgaaagaaacaaggataacta |
19142781 |
T |
|
| Q |
135 |
tatgtattaagaaatggttataccttatgtagctgtttggtgtaaagttacaactatggtaaaatggttgcaaaatatggaagtgggttg |
224 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19142782 |
tatgtattaagaaatggttataccttatgtagttgtttggtgtaaagctacaactatggtaaaatggttgcaaaatatggaagtgggttg |
19142871 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University