View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18629_low_30 (Length: 226)
Name: NF18629_low_30
Description: NF18629
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18629_low_30 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 206; Significance: 1e-113; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 206; E-Value: 1e-113
Query Start/End: Original strand, 1 - 214
Target Start/End: Original strand, 50701171 - 50701384
Alignment:
| Q |
1 |
atgtcttctccttctctctcatggcatccaccctactgttatctctgattcacttcacaaagcctcggttaaagctgttgacgttctcaccgccatggct |
100 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50701171 |
atgtcttctccttctctctcatggtatccaccctactgttatctctgattcacttcacaaagcctcggttaaagctgttgacgttctcaccgccatggct |
50701270 |
T |
|
| Q |
101 |
gtgccggttgaactcactgatcgtgattctcttgtgaaatctgctagcacttcgttgaacagtaaggttgttagtcagtactcttcgcttcttgctccta |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
50701271 |
gtgccggttgaactcactgatcgtgattctcttgtgaaatctgctagcacttcgttgaacagtaaagttgttagtcagtactcttcgcttcttgctccta |
50701370 |
T |
|
| Q |
201 |
tcgctgttgattca |
214 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
50701371 |
tcgctgttgattca |
50701384 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 33; Significance: 0.000000001; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 39 - 115
Target Start/End: Original strand, 44730680 - 44730756
Alignment:
| Q |
39 |
ttatctctgattcacttcacaaagcctcggttaaagctgttgacgttctcaccgccatggctgtgccggttgaactc |
115 |
Q |
| |
|
|||||||||||||||||| |||||| || || ||||| | ||| | |||||||||||||| || |||||||||||| |
|
|
| T |
44730680 |
ttatctctgattcacttctcaaagcatccgtcaaagccttggacatcctcaccgccatggcagttccggttgaactc |
44730756 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University