View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1862_high_17 (Length: 225)
Name: NF1862_high_17
Description: NF1862
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1862_high_17 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 161; Significance: 5e-86; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 161; E-Value: 5e-86
Query Start/End: Original strand, 41 - 209
Target Start/End: Complemental strand, 4371318 - 4371150
Alignment:
| Q |
41 |
atcagttttgaacaatttttcaaaatagtccaaaatcatattaatgttagacatgttacatacaaaatatctctcacaaaatatctagctactaaccaaa |
140 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4371318 |
atcatttttgaacaatttttcaaaatagtccaaaatcatattaacgttagacatgttacatacaaaatatctctcacaaaatatctagctactaaccaaa |
4371219 |
T |
 |
| Q |
141 |
atgactcatttttcaaacagtatatgagatcttctttggaagcatcagctgcggcaattgggaagaaag |
209 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4371218 |
atgactcatttttcaaacagtatatgagatcttctttggaagcatcagctgcggcaattgggaagaaag |
4371150 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 154 - 209
Target Start/End: Complemental strand, 4363402 - 4363347
Alignment:
| Q |
154 |
caaacagtatatgagatcttctttggaagcatcagctgcggcaattgggaagaaag |
209 |
Q |
| |
|
|||||||||||||||||| || ||||||||| |||| | |||||||||||||||| |
|
|
| T |
4363402 |
caaacagtatatgagatcatccttggaagcaacagcaggagcaattgggaagaaag |
4363347 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 59; Significance: 4e-25; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 59; E-Value: 4e-25
Query Start/End: Original strand, 116 - 209
Target Start/End: Original strand, 931355 - 931449
Alignment:
| Q |
116 |
acaaaatatctagctactaa----ccaaaatgactcatttttcaaacagtatatgagatcttctttggaagcatcagctgcggcaattgggaagaaag |
209 |
Q |
| |
|
|||||||||||||||||||| ||||||| |||||||||||||||||||||||||| ||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
931355 |
acaaaatatctagctactaattaaccaaaataactcatttttcaaacagtatatgaga---tctttggaagcatcagctgcggcaattggaaagaaag |
931449 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 59; E-Value: 4e-25
Query Start/End: Original strand, 116 - 209
Target Start/End: Complemental strand, 10607936 - 10607842
Alignment:
| Q |
116 |
acaaaatatctagctac----taaccaaaatgactcatttttcaaacagtatatgagatcttctttggaagcatcagctgcggcaattgggaagaaag |
209 |
Q |
| |
|
|||||| |||||||||| |||||||||| |||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10607936 |
acaaaacatctagctactaattaaccaaaataactcatttttcaaacagtatatgaga---tctttggaagcatcagctgcggcaattgggaagaaag |
10607842 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 59; Significance: 4e-25; HSPs: 5)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 59; E-Value: 4e-25
Query Start/End: Original strand, 116 - 209
Target Start/End: Complemental strand, 12589820 - 12589726
Alignment:
| Q |
116 |
acaaaatatctagctactaa----ccaaaatgactcatttttcaaacagtatatgagatcttctttggaagcatcagctgcggcaattgggaagaaag |
209 |
Q |
| |
|
|||||||||||||||||||| ||||||| |||||||||||||||||||||||||| |||||||||||||||| |||||||||||||||||||| |
|
|
| T |
12589820 |
acaaaatatctagctactaattaaccaaaataactcatttttcaaacagtatatgaga---tctttggaagcatcagttgcggcaattgggaagaaag |
12589726 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 59; E-Value: 4e-25
Query Start/End: Original strand, 116 - 209
Target Start/End: Original strand, 46764683 - 46764777
Alignment:
| Q |
116 |
acaaaatatctagctactaa----ccaaaatgactcatttttcaaacagtatatgagatcttctttggaagcatcagctgcggcaattgggaagaaag |
209 |
Q |
| |
|
|||||||||||||||||||| ||||||| |||||||||||||||||||||||||| |||||||||||||||| |||||||||||||||||||| |
|
|
| T |
46764683 |
acaaaatatctagctactaattaaccaaaataactcatttttcaaacagtatatgaga---tctttggaagcatcagttgcggcaattgggaagaaag |
46764777 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 55; E-Value: 9e-23
Query Start/End: Original strand, 116 - 209
Target Start/End: Original strand, 11680776 - 11680869
Alignment:
| Q |
116 |
acaaaatatctagctactaa----ccaaaatgactcatttttcaaacagtatatgagatcttctttggaagcatcagctgcggcaattgggaagaaag |
209 |
Q |
| |
|
|||||||||||||||||||| ||||||| ||||||||||||| |||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
11680776 |
acaaaatatctagctactaattaaccaaaataactcatttttcaa-cagtatatgagatctt---tggaagcatcagctgcggcaattgggaagaaag |
11680869 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #4
Raw Score: 55; E-Value: 9e-23
Query Start/End: Original strand, 116 - 209
Target Start/End: Original strand, 11689055 - 11689148
Alignment:
| Q |
116 |
acaaaatatctagctactaa----ccaaaatgactcatttttcaaacagtatatgagatcttctttggaagcatcagctgcggcaattgggaagaaag |
209 |
Q |
| |
|
|||||||||||||||||||| ||||||| ||||||||||||| |||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
11689055 |
acaaaatatctagctactaattaaccaaaataactcatttttcaa-cagtatatgagatctt---tggaagcatcagctgcggcaattgggaagaaag |
11689148 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #5
Raw Score: 55; E-Value: 9e-23
Query Start/End: Original strand, 133 - 209
Target Start/End: Complemental strand, 25655235 - 25655162
Alignment:
| Q |
133 |
taaccaaaatgactcatttttcaaacagtatatgagatcttctttggaagcatcagctgcggcaattgggaagaaag |
209 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||| |||||||||||||||| |||||||||||||||||||| |
|
|
| T |
25655235 |
taaccaaaataactcatttttcaaacagtatatgaga---tctttggaagcatcagttgcggcaattgggaagaaag |
25655162 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University