View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1862_high_18 (Length: 213)

Name: NF1862_high_18
Description: NF1862
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1862_high_18
NF1862_high_18
[»] chr1 (1 HSPs)
chr1 (104-177)||(51015109-51015182)


Alignment Details
Target: chr1 (Bit Score: 70; Significance: 1e-31; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 70; E-Value: 1e-31
Query Start/End: Original strand, 104 - 177
Target Start/End: Original strand, 51015109 - 51015182
Alignment:
104 acaaatataaggactttattttttaaagataatgttatgaacttatgatcacatacgaatatcttttattggcg 177  Q
    ||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
51015109 acaaatatatggactttattttttaaagataatgttatgaacttatgatcacatacgaatatcttttattggcg 51015182  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University