View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1862_high_7 (Length: 273)
Name: NF1862_high_7
Description: NF1862
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1862_high_7 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 187; Significance: 1e-101; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 187; E-Value: 1e-101
Query Start/End: Original strand, 1 - 255
Target Start/End: Complemental strand, 41040069 - 41039816
Alignment:
| Q |
1 |
aagcatatgacaaacattcaggtcaagtatggatccttatcaaaatatgacaaataaataagccaagttgccaattatatttcataatttattattnnnn |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
41040069 |
aagcatatgacaaacattcaggtcaagtatggacccttatcaaaatatgacaaataaataagccaagttgccaactatatttcataatttattattaaaa |
41039970 |
T |
|
| Q |
101 |
nnnnttattgtggttatgaacccccttcaaatattgaagaaaaattggatacccgaaattcgccgataaacccctaccttttgaagtaattcaatgttta |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| || ||||||||||||||||||||| |
|
|
| T |
41039969 |
aaaaatattgtggttatgaacccccttcaaatattgaagaaaaattggatacctgaaattcgccgataaacccct-ccctttgaagtaattcaatgttta |
41039871 |
T |
|
| Q |
201 |
aagccaaagctccaagtccgtaagctactcagattgaacttaatgatctaccatt |
255 |
Q |
| |
|
||| ||||||||||||| ||| |||||||||||||||||||||||||||||||| |
|
|
| T |
41039870 |
aagaaaaagctccaagtcagtaggctactcagattgaacttaatgatctaccatt |
41039816 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University