View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1862_low_12 (Length: 244)
Name: NF1862_low_12
Description: NF1862
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1862_low_12 |
 | |
|
| [»] chr2 (1 HSPs) |
| |
|
Alignment Details
Target: chr2 (Bit Score: 192; Significance: 1e-104; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 192; E-Value: 1e-104
Query Start/End: Original strand, 45 - 244
Target Start/End: Complemental strand, 40709167 - 40708968
Alignment:
| Q |
45 |
tttttgatcacttcctcccctgccatagtttccatgcgtcctttatatatcttgcaagtggctaaatgcttaatcaatttctttattaccgttgccacat |
144 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
40709167 |
tttttgatcacttcctccccggccatagtttccatgcgtcctttatatatcttgcaagtggctaaatgcttaatcaatttcttcattaccgttgccacat |
40709068 |
T |
|
| Q |
145 |
tttcatagaaaatcaatgatattaatggccatgaaagcctaagaacaacggttagataaactctataacggtaagcatttaaaccaattgagtaaaggac |
244 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40709067 |
tttcatagaaaatcaatgatattaatggccatgaaagcctaagaacaacggttagataaactctataacggtaagcatttaaaccaattgagtaaaggac |
40708968 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University