View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1862_low_13 (Length: 238)
Name: NF1862_low_13
Description: NF1862
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1862_low_13 |
 | |
|
| [»] chr4 (1 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 180; Significance: 2e-97; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 180; E-Value: 2e-97
Query Start/End: Original strand, 18 - 238
Target Start/End: Original strand, 4164335 - 4164555
Alignment:
| Q |
18 |
ggaccagatataaggtggttcaccataaaacttatatattacaatatatacatatgatattatgtttatnnnnnnntaatagtatgacaaatgtctccaa |
117 |
Q |
| |
|
|||||||||||||| ||||||||| ||||||||| |||| ||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
4164335 |
ggaccagatataagatggttcaccgtaaaacttacatatgacaatatatacatatgatattatgtttataaaaaaataatagtatgacaaatgtctccaa |
4164434 |
T |
|
| Q |
118 |
aaatttatatagcatagtgcttctcttgatggtaattattaggaccttatattatagggcaaagaagattaacacatatggtgaaagatctaaaatgaaa |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
4164435 |
aaatttatatagcatagtgcttctcttgatggtaattattaggaccttatattatagggcaaagaagattaacacatatggtcaaagatctaaaatgaaa |
4164534 |
T |
|
| Q |
218 |
tatcttgtgctagatagatct |
238 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
4164535 |
tatcttgtgctagatagatct |
4164555 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University