View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1862_low_14 (Length: 237)
Name: NF1862_low_14
Description: NF1862
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1862_low_14 |
 |  |
|
| [»] chr1 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 181; Significance: 6e-98; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 181; E-Value: 6e-98
Query Start/End: Original strand, 17 - 237
Target Start/End: Original strand, 44764271 - 44764491
Alignment:
| Q |
17 |
agttgcattgtttattccagttgcttcaaattaagctcatgtatttgtgttctaattaaagttatgaatttctaattaatgtcagcgagttctatagttt |
116 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |||| ||| |||||||||| |
|
|
| T |
44764271 |
agttgcattgtttattctagttgcttcaaattaagctcatgtatttgtgttctaattaaatctatgaatttctaattaatttcagtgagatctatagttt |
44764370 |
T |
 |
| Q |
117 |
aaatgatgcatgcactttactcactgttggtaagagtgaccatacatagattctcataaaatttagggaagtgacttgcgaatggtcaatgttttgattt |
216 |
Q |
| |
|
||||||||||||| || |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
44764371 |
gaatgatgcatgcaattaactcactgttggtaagagtgaccatacatagattctcataaaatttagggaagtgacttgcgaatggtcattgttttgattt |
44764470 |
T |
 |
| Q |
217 |
gattttttgatcttactaatt |
237 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
44764471 |
gattttttgatcttactaatt |
44764491 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University