View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1862_low_17 (Length: 231)
Name: NF1862_low_17
Description: NF1862
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1862_low_17 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 154; Significance: 8e-82; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 154; E-Value: 8e-82
Query Start/End: Original strand, 65 - 222
Target Start/End: Complemental strand, 10231457 - 10231300
Alignment:
| Q |
65 |
acctcaatgctgagccacctgtatgcaaaattctcctgtgtaatttgacttcttattttgctttggtatgatatagccttctttatggagctgaagaccc |
164 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10231457 |
acctcaatgctgagccacctgtatgcaagattctcctgtgtaatttgacttcttattttgctttggtatgatatagccttctttatggagctgaagaccc |
10231358 |
T |
 |
| Q |
165 |
ttctattgctggactggtgttggacagcgccttttcaaacttgtacgacttgatgatg |
222 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10231357 |
ttctattgctggactggtgttggacagcgccttttcaaacttgtacgacttgatgatg |
10231300 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 54; Significance: 4e-22; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 54; E-Value: 4e-22
Query Start/End: Original strand, 121 - 206
Target Start/End: Complemental strand, 56247834 - 56247749
Alignment:
| Q |
121 |
tttgctttggtatgatatagccttctttatggagctgaagacccttctattgctggactggtgttggacagcgccttttcaaactt |
206 |
Q |
| |
|
||||||||||| ||| |||||||||||||||||| ||||||||||||||||||||| |||| ||||| ||||||||||| ||||| |
|
|
| T |
56247834 |
tttgctttggtgggatttagccttctttatggagccgaagacccttctattgctggaatggtattggatagcgccttttctaactt |
56247749 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University