View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1862_low_7 (Length: 331)
Name: NF1862_low_7
Description: NF1862
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1862_low_7 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 103; Significance: 3e-51; HSPs: 3)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 103; E-Value: 3e-51
Query Start/End: Original strand, 132 - 276
Target Start/End: Complemental strand, 17274491 - 17274346
Alignment:
| Q |
132 |
cttctttttaatctatatatctgaattaaaatgctaatctgaagcatttgctacttcagtgannnnnnnnn-agctatttagtttttaaaatagttactt |
230 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
17274491 |
cttctttttaatctatatatctgaattaaaatgctaatctgaagcatttgctacttcagtgattttatttttagctatttagtttttaaaatagttactt |
17274392 |
T |
|
| Q |
231 |
gcaatgcaagtaactaagagaaggtagttgctataaatgtaactaa |
276 |
Q |
| |
|
||||||||||||||||||||||| || ||||||||||||||||||| |
|
|
| T |
17274391 |
gcaatgcaagtaactaagagaagttacttgctataaatgtaactaa |
17274346 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 18 - 74
Target Start/End: Complemental strand, 17274545 - 17274489
Alignment:
| Q |
18 |
tttttatgttctcatatttaattcttagctttatttttgtaagcaaaaacagacctt |
74 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||||||||||| |||||||| |
|
|
| T |
17274545 |
tttttatgttctcatatttaagtcttagctttatttttgtaagcaaatgcagacctt |
17274489 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 119 - 193
Target Start/End: Complemental strand, 17258938 - 17258864
Alignment:
| Q |
119 |
tggagtaactaatcttctttttaatctatatatctgaattaaaatgctaatctgaagcatttgctacttcagtga |
193 |
Q |
| |
|
|||||||| |||||||| | ||||| ||||||||||||||||||| |||||||||||||||| ||||||||| |
|
|
| T |
17258938 |
tggagtaattaatcttcgcgtaaatcttaatatctgaattaaaatgcttatctgaagcatttgcttcttcagtga |
17258864 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University