View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18632_high_10 (Length: 413)
Name: NF18632_high_10
Description: NF18632
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18632_high_10 |
 | |
|
| [»] scaffold0004 (1 HSPs) |
| | |
|
Alignment Details
Target: scaffold0004 (Bit Score: 365; Significance: 0; HSPs: 1)
Name: scaffold0004
Description:
Target: scaffold0004; HSP #1
Raw Score: 365; E-Value: 0
Query Start/End: Original strand, 19 - 399
Target Start/End: Original strand, 374525 - 374905
Alignment:
| Q |
19 |
gttttcacttcactctttggtgtagggttttggggaaacaatcacaatttctactattatttagtcattcaaatgatttctggtttgtttcaatccactg |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
374525 |
gttttcacttcactctttggtgtagggttttggggaaacaatcacaatttctactattatttagtcattcaaatgattgctggtttgtttcaatccactg |
374624 |
T |
|
| Q |
119 |
gatggccatccgtagttgcggttttgggtaactggtttggaaagcggaagagagggttgatcatgggaatttggaatgctcatacttctgtcgggaacat |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
374625 |
gatggccatccgtagttgcggttttgggtaactggtttggaaagcggaagagagggttgatcatgggaatttggaatgctcatacttctgtcgggaacat |
374724 |
T |
|
| Q |
219 |
tgctggttctttgattgcttctgctatgttgggatatggatggggatggtctttcgttgtgcccggattaataatgtctttccttggtttggtggttttc |
318 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
374725 |
tgctggttctttgattgcttctgctatgttgggatatggatggggatggtcttttgttgtgcctggattaataatgtctttccttggtttggtggttttc |
374824 |
T |
|
| Q |
319 |
ctaatattgcctgtctcacctgagtctgccggagtcgaagaagatgattatagttgtcctaagaaaagcggagatgatgtc |
399 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
374825 |
ctaatattgcctgtctcacctgagtctgccggagttgaagaagatgattatagttgtcctaagaaaagcggagatgatgtc |
374905 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 49; Significance: 7e-19; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 49; E-Value: 7e-19
Query Start/End: Original strand, 88 - 228
Target Start/End: Original strand, 41288123 - 41288263
Alignment:
| Q |
88 |
caaatgatttctggtttgtttcaatccactggatggccatccgtagttgcggttttgggtaactggtttggaaagcggaagagagggttgatcatgggaa |
187 |
Q |
| |
|
||||||||| |||| ||||||||| | || || ||||| || || || || ||| | |||||||||||||| ||| |||||||||| ||||| ||||| | |
|
|
| T |
41288123 |
caaatgattgctgggttgtttcaagcgacgggttggccgtcggtcgtcgccgttatcggtaactggtttgggaagaggaagagaggtttgataatgggta |
41288222 |
T |
|
| Q |
188 |
tttggaatgctcatacttctgtcgggaacattgctggttct |
228 |
Q |
| |
|
|||||||||| ||||||||||| ||||| ||| ||||||| |
|
|
| T |
41288223 |
tttggaatgcacatacttctgttgggaatattagtggttct |
41288263 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University